Incidental Mutation 'R0925:Rsl1d1'
ID83169
Institutional Source Beutler Lab
Gene Symbol Rsl1d1
Ensembl Gene ENSMUSG00000005846
Gene Nameribosomal L1 domain containing 1
Synonyms
MMRRC Submission 039072-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.923) question?
Stock #R0925 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location11192970-11203331 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11199689 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 138 (Y138N)
Ref Sequence ENSEMBL: ENSMUSP00000113431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119953] [ENSMUST00000230002]
Predicted Effect probably damaging
Transcript: ENSMUST00000119953
AA Change: Y138N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113431
Gene: ENSMUSG00000005846
AA Change: Y138N

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
Pfam:Ribosomal_L1 36 259 2.3e-52 PFAM
coiled coil region 281 313 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181526
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229756
Predicted Effect probably benign
Transcript: ENSMUST00000230002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230166
Predicted Effect probably benign
Transcript: ENSMUST00000230232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230245
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T A 2: 173,526,074 S47T probably benign Het
Adam5 T C 8: 24,812,425 Q101R probably benign Het
C2cd4c T C 10: 79,612,750 N188D probably benign Het
Cdc27 A G 11: 104,526,049 probably null Het
Cdh11 T A 8: 102,634,724 I661L probably damaging Het
Csmd1 A G 8: 16,710,618 I167T probably benign Het
Dennd3 T G 15: 73,533,435 F346V probably damaging Het
Dis3l A T 9: 64,341,130 M1K probably null Het
Dnajb6 A T 5: 29,752,400 K60I probably damaging Het
Dock10 T A 1: 80,536,940 H1421L probably benign Het
Elmod3 A T 6: 72,568,938 C274S probably damaging Het
Eme1 T C 11: 94,650,732 E88G probably damaging Het
Fam227a A T 15: 79,620,805 M475K probably benign Het
Frem2 T C 3: 53,653,973 I1038V probably benign Het
Gabpb1 T A 2: 126,652,265 N147Y probably damaging Het
Gm5346 T C 8: 43,626,303 I295V probably benign Het
Gmnc A G 16: 26,960,423 L278P probably benign Het
Gpr153 A G 4: 152,281,874 T299A probably benign Het
H2-M11 T C 17: 36,547,461 V49A probably benign Het
Hemgn T A 4: 46,397,049 K62N probably damaging Het
Hormad2 G A 11: 4,427,297 T47M probably damaging Het
Iqcf6 A G 9: 106,627,301 T55A probably benign Het
Itgam T C 7: 128,112,238 F705L probably benign Het
Klk1 T A 7: 44,228,816 probably null Het
Myo1f A T 17: 33,578,133 I123F probably damaging Het
Nupl1 T C 14: 60,220,141 T538A probably damaging Het
Olfr510 C T 7: 108,668,193 T259I probably benign Het
Olfr592 T A 7: 103,186,823 L74* probably null Het
Pdzd2 C T 15: 12,399,270 R790H probably damaging Het
Pigv T C 4: 133,662,649 K74R probably benign Het
Prmt8 T C 6: 127,697,813 K284R probably benign Het
Scara5 AC ACC 14: 65,762,718 probably benign Het
Smc4 T A 3: 69,006,215 probably benign Het
Spta1 G A 1: 174,174,426 V41I possibly damaging Het
Tdrd7 C A 4: 46,025,758 N859K probably damaging Het
Vps13d T G 4: 145,156,551 D824A probably damaging Het
Wdfy2 A T 14: 62,930,226 probably null Het
Other mutations in Rsl1d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Rsl1d1 APN 16 11199694 missense probably damaging 1.00
IGL01087:Rsl1d1 APN 16 11194675 missense possibly damaging 0.85
IGL01998:Rsl1d1 APN 16 11194645 missense possibly damaging 0.79
IGL02077:Rsl1d1 APN 16 11194456 unclassified probably benign
IGL02627:Rsl1d1 APN 16 11194551 missense possibly damaging 0.48
R1017:Rsl1d1 UTSW 16 11203252 missense probably benign
R1671:Rsl1d1 UTSW 16 11201381 missense probably damaging 1.00
R4658:Rsl1d1 UTSW 16 11201374 missense probably damaging 1.00
R4915:Rsl1d1 UTSW 16 11199729 splice site probably null
R5265:Rsl1d1 UTSW 16 11201384 missense possibly damaging 0.82
R5545:Rsl1d1 UTSW 16 11199650 missense probably damaging 0.99
R6221:Rsl1d1 UTSW 16 11201311 missense probably damaging 0.99
R6970:Rsl1d1 UTSW 16 11193694 missense probably benign 0.06
R7852:Rsl1d1 UTSW 16 11203234 missense probably benign
R7935:Rsl1d1 UTSW 16 11203234 missense probably benign
Z1088:Rsl1d1 UTSW 16 11202385 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGGCATCAGAACATTGGAGACACAC -3'
(R):5'- TGACATGCTGGGATTTTATCCAGGC -3'

Sequencing Primer
(F):5'- GAACATTGGAGACACACAGAAAC -3'
(R):5'- AGGGTCTCCCACCATCTG -3'
Posted On2013-11-08