Incidental Mutation 'R1136:Ercc6l2'
ID95043
Institutional Source Beutler Lab
Gene Symbol Ercc6l2
Ensembl Gene ENSMUSG00000021470
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 6 like 2
Synonyms0610007P08Rik, 1700019D06Rik, 9330134C04Rik
MMRRC Submission 039209-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.368) question?
Stock #R1136 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location63815240-63900302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63869120 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 679 (V679D)
Ref Sequence ENSEMBL: ENSMUSP00000069488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067821] [ENSMUST00000095724] [ENSMUST00000159957]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067821
AA Change: V679D

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000069488
Gene: ENSMUSG00000021470
AA Change: V679D

DomainStartEndE-ValueType
DEXDc 118 331 1.94e-33 SMART
Blast:DEXDc 380 425 3e-13 BLAST
HELICc 536 619 3.12e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095724
SMART Domains Protein: ENSMUSP00000093392
Gene: ENSMUSG00000021470

DomainStartEndE-ValueType
DEXDc 1 183 2.72e-14 SMART
Blast:DEXDc 232 277 3e-13 BLAST
HELICc 388 471 3.12e-23 SMART
low complexity region 817 827 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109776
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000159957
SMART Domains Protein: ENSMUSP00000124912
Gene: ENSMUSG00000021470

DomainStartEndE-ValueType
Pfam:SNF2_N 101 195 2.1e-8 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Snf2 family of helicase-like proteins. The encoded protein may play a role in DNA repair and mitochondrial function. Mutations in this gene have been associated with bone marrow failure syndrome 2. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 C T 13: 68,730,317 G401S probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Bmp2 T C 2: 133,560,927 F133L probably damaging Het
C1qtnf3 A G 15: 10,978,584 E290G probably damaging Het
Ccdc180 C A 4: 45,914,589 D701E probably benign Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Csmd3 A T 15: 47,675,817 I1508N probably damaging Het
Dgkh T C 14: 78,624,889 R80G probably damaging Het
Dock1 T A 7: 134,848,173 V805D possibly damaging Het
Eef2 C CN 10: 81,178,769 probably null Het
Esp6 T C 17: 40,565,393 Y111H probably benign Het
Focad T C 4: 88,326,180 F799S unknown Het
Foxred1 C A 9: 35,205,037 M438I probably benign Het
Galnt11 T G 5: 25,258,945 V405G probably damaging Het
Gm4847 A G 1: 166,630,366 Y473H probably damaging Het
Gpbp1l1 C T 4: 116,592,918 T461M probably damaging Het
Hnrnpu A T 1: 178,331,225 probably benign Het
Kmt2d A T 15: 98,857,765 probably benign Het
Matr3 A G 18: 35,572,895 H291R probably damaging Het
Mfsd14b C T 13: 65,095,692 S46N probably benign Het
Mtch1 C T 17: 29,333,770 probably null Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mylk T C 16: 35,000,318 I1880T probably damaging Het
N4bp2 T C 5: 65,808,472 L1288P probably damaging Het
Ncf2 A T 1: 152,830,372 H245L probably damaging Het
Nmd3 T A 3: 69,746,716 probably benign Het
Npdc1 G T 2: 25,407,715 A127S probably benign Het
Nudt3 C A 17: 27,623,106 R27L probably benign Het
Nwd1 C T 8: 72,697,769 probably benign Het
Papd4 C T 13: 93,175,697 probably null Het
Pex7 T A 10: 19,888,688 I170F probably benign Het
Phyhipl A G 10: 70,569,072 V57A probably damaging Het
Pkhd1 G A 1: 20,522,829 P1687S possibly damaging Het
Plekhj1 A T 10: 80,797,820 probably null Het
Prss21 T A 17: 23,872,994 L312H probably damaging Het
Samsn1 T C 16: 75,873,520 I232V probably null Het
Sec63 A T 10: 42,806,546 D411V probably damaging Het
Slc44a4 C T 17: 34,928,022 H343Y probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmtc3 A G 10: 100,472,043 probably benign Het
Trafd1 C T 5: 121,373,324 R477H possibly damaging Het
Uhrf2 T A 19: 30,056,226 probably benign Het
Vmn2r68 T A 7: 85,222,341 D578V possibly damaging Het
Wdcp G A 12: 4,851,655 V504I possibly damaging Het
Wdr93 T C 7: 79,773,448 Y487H probably damaging Het
Zfp457 T C 13: 67,293,782 H147R probably damaging Het
Other mutations in Ercc6l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Ercc6l2 APN 13 63858319 missense probably damaging 0.99
IGL00678:Ercc6l2 APN 13 63844613 missense probably damaging 1.00
IGL00765:Ercc6l2 APN 13 63848772 missense possibly damaging 0.95
IGL01062:Ercc6l2 APN 13 63847454 missense probably null 1.00
IGL01655:Ercc6l2 APN 13 63819752 nonsense probably null
IGL02175:Ercc6l2 APN 13 63869190 utr 3 prime probably benign
IGL02201:Ercc6l2 APN 13 63852969 missense probably benign 0.12
IGL02351:Ercc6l2 APN 13 63853683 missense probably damaging 1.00
IGL02358:Ercc6l2 APN 13 63853683 missense probably damaging 1.00
IGL02622:Ercc6l2 APN 13 63853623 unclassified probably null
PIT4812001:Ercc6l2 UTSW 13 63858257 missense possibly damaging 0.58
R0142:Ercc6l2 UTSW 13 63872506 unclassified probably benign
R0648:Ercc6l2 UTSW 13 63844645 missense probably benign 0.04
R1536:Ercc6l2 UTSW 13 63824871 missense possibly damaging 0.81
R1706:Ercc6l2 UTSW 13 63872458 unclassified probably benign
R2108:Ercc6l2 UTSW 13 63871988 unclassified probably benign
R2111:Ercc6l2 UTSW 13 63834749 missense probably damaging 1.00
R2126:Ercc6l2 UTSW 13 63848771 missense probably damaging 1.00
R2154:Ercc6l2 UTSW 13 63866007 missense probably damaging 1.00
R3551:Ercc6l2 UTSW 13 63844595 missense probably damaging 1.00
R3773:Ercc6l2 UTSW 13 63841450 missense probably damaging 1.00
R3923:Ercc6l2 UTSW 13 63870735 unclassified probably benign
R4233:Ercc6l2 UTSW 13 63872168 unclassified probably benign
R4782:Ercc6l2 UTSW 13 63834738 missense probably damaging 1.00
R4928:Ercc6l2 UTSW 13 63894813 utr 3 prime probably benign
R5163:Ercc6l2 UTSW 13 63899031 utr 3 prime probably benign
R5268:Ercc6l2 UTSW 13 63869111 missense possibly damaging 0.92
R5423:Ercc6l2 UTSW 13 63872258 unclassified probably benign
R6128:Ercc6l2 UTSW 13 63853749 missense probably damaging 0.98
R6164:Ercc6l2 UTSW 13 63872344 unclassified probably benign
R7238:Ercc6l2 UTSW 13 63865984 missense probably damaging 0.98
R7295:Ercc6l2 UTSW 13 63819775 missense probably damaging 0.96
R7708:Ercc6l2 UTSW 13 63841514 nonsense probably null
RF013:Ercc6l2 UTSW 13 63853017 missense probably benign 0.06
Z1088:Ercc6l2 UTSW 13 63853728 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CAGGGAGTGCCAGGAAATTCTGAC -3'
(R):5'- TGTCTGAAAATGCCCACGGAGG -3'

Sequencing Primer
(F):5'- GTGCCAGGAAATTCTGACATACTG -3'
(R):5'- ATGCCCACGGAGGTCATATTATC -3'
Posted On2014-01-05