Incidental Mutation 'R0992:Disc1'
ID97771
Institutional Source Beutler Lab
Gene Symbol Disc1
Ensembl Gene ENSMUSG00000043051
Gene Namedisrupted in schizophrenia 1
Synonyms
MMRRC Submission 039112-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.425) question?
Stock #R0992 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location125054195-125261858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125088042 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 215 (I215T)
Ref Sequence ENSEMBL: ENSMUSP00000112593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074562] [ENSMUST00000075730] [ENSMUST00000098311] [ENSMUST00000115885] [ENSMUST00000117658] [ENSMUST00000118942] [ENSMUST00000121953] [ENSMUST00000122389]
Predicted Effect probably damaging
Transcript: ENSMUST00000074562
AA Change: I215T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074147
Gene: ENSMUSG00000043051
AA Change: I215T

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075730
AA Change: I215T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075145
Gene: ENSMUSG00000043051
AA Change: I215T

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098311
AA Change: I215T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095914
Gene: ENSMUSG00000043051
AA Change: I215T

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115885
AA Change: I215T

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111552
Gene: ENSMUSG00000043051
AA Change: I215T

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117658
AA Change: I215T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112757
Gene: ENSMUSG00000043051
AA Change: I215T

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118942
AA Change: I215T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112410
Gene: ENSMUSG00000043051
AA Change: I215T

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121953
AA Change: I213T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112929
Gene: ENSMUSG00000043051
AA Change: I213T

DomainStartEndE-ValueType
low complexity region 218 228 N/A INTRINSIC
low complexity region 286 322 N/A INTRINSIC
coiled coil region 370 395 N/A INTRINSIC
coiled coil region 447 494 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
low complexity region 622 634 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122389
AA Change: I215T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112593
Gene: ENSMUSG00000043051
AA Change: I215T

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126111
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple coiled coil motifs which is located in the nucleus, cytoplasm and mitochondria. The protein is involved in neurite outgrowth and cortical development through its interaction with other proteins. This gene is disrupted in a t(1;11)(q42.1;q14.3) translocation which segregates with schizophrenia and related psychiatric disorders in a large Scottish family. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show altered anxiety, synaptic depression, LTP, impulsivity, social investigation, hyperactivity and prepulse inhibition. Homozygotes for a spontaneous allele show altered working memory. Different ENU mutations cause distinct depression and schizophrenia-like profiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,211,684 T905A probably damaging Het
Arhgap20 A G 9: 51,816,786 R100G probably damaging Het
Bsn G A 9: 108,114,354 R1400* probably null Het
Clstn2 A G 9: 97,445,712 S948P probably benign Het
Col15a1 G A 4: 47,300,491 V1029M probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dst A G 1: 34,199,536 N3773S probably damaging Het
Gdap1 A G 1: 17,147,105 Y96C probably damaging Het
Glipr1l1 A G 10: 112,062,325 R112G probably benign Het
Gria4 A G 9: 4,795,238 S13P probably benign Het
Noxred1 T C 12: 87,224,226 N207S probably benign Het
Pom121l2 A T 13: 21,982,759 Q400L probably benign Het
Sla2 T C 2: 156,874,472 E243G probably damaging Het
Srpk2 A G 5: 23,545,543 I54T probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Trim15 C T 17: 36,865,011 V215M probably damaging Het
Uchl3 T C 14: 101,668,533 I144T probably benign Het
Other mutations in Disc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Disc1 APN 8 125088275 missense probably benign 0.27
IGL01319:Disc1 APN 8 125087891 missense probably damaging 0.99
IGL02001:Disc1 APN 8 125251042 missense probably damaging 0.97
IGL02403:Disc1 APN 8 125135519 splice site probably benign
IGL02445:Disc1 APN 8 125148403 splice site probably benign
R0334:Disc1 UTSW 8 125261097 splice site probably null
R1654:Disc1 UTSW 8 125148465 missense possibly damaging 0.90
R1711:Disc1 UTSW 8 125124610 missense probably benign 0.05
R3154:Disc1 UTSW 8 125135304 missense probably damaging 1.00
R3947:Disc1 UTSW 8 125088135 missense probably damaging 1.00
R3948:Disc1 UTSW 8 125088135 missense probably damaging 1.00
R3949:Disc1 UTSW 8 125088135 missense probably damaging 1.00
R4051:Disc1 UTSW 8 125148425 missense possibly damaging 0.85
R4199:Disc1 UTSW 8 125148459 missense probably damaging 1.00
R4691:Disc1 UTSW 8 125148447 missense possibly damaging 0.90
R4763:Disc1 UTSW 8 125124538 missense probably damaging 1.00
R4825:Disc1 UTSW 8 125135302 missense possibly damaging 0.86
R4969:Disc1 UTSW 8 125124550 nonsense probably null
R5087:Disc1 UTSW 8 125132160 missense probably benign
R5383:Disc1 UTSW 8 125135457 missense probably damaging 1.00
R5827:Disc1 UTSW 8 125135365 missense probably damaging 1.00
R5828:Disc1 UTSW 8 125251024 missense probably damaging 0.99
R6431:Disc1 UTSW 8 125135389 missense possibly damaging 0.87
R6501:Disc1 UTSW 8 125218105 missense probably benign 0.00
R6794:Disc1 UTSW 8 125087775 missense probably benign 0.37
R7058:Disc1 UTSW 8 125250985 missense probably damaging 1.00
R7350:Disc1 UTSW 8 125165102 missense probably damaging 1.00
R7365:Disc1 UTSW 8 125155041 missense probably damaging 1.00
R7732:Disc1 UTSW 8 125250975 nonsense probably null
R7757:Disc1 UTSW 8 125087504 missense probably benign 0.03
R8113:Disc1 UTSW 8 125088275 missense probably benign 0.27
R8179:Disc1 UTSW 8 125087577 missense probably benign 0.05
R8400:Disc1 UTSW 8 125232993 missense probably benign 0.02
R8459:Disc1 UTSW 8 125165155 missense possibly damaging 0.91
R8492:Disc1 UTSW 8 125090438 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGACAGCTTTAAGTCTCTGGCTCC -3'
(R):5'- AGACCGTGCCACATTCTGATTGC -3'

Sequencing Primer
(F):5'- GGCTCCTAGCCTTGATGC -3'
(R):5'- TGTCACCTGAGCCAAGTCC -3'
Posted On2014-01-05