Phenotypic Mutation 'Arruda' (pdf version)
AlleleArruda
Mutation Type missense
Chromosome13
Coordinate11,643,895 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Ryr2
Gene Name ryanodine receptor 2, cardiac
Synonym(s) 9330127I20Rik
Chromosomal Location 11,553,102-12,106,945 bp (-)
MGI Phenotype Strain: 3640298
Lethality: E9-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show embryonic lethality during organogenesis and altered cardiomyocyte morphology. Homozygotes for a phosphorylation defective allele show decreased susceptibility to myocardial infarction-induced heart failure. Homozygotes for the R420W allele show lymphoid organ hypertrophy. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_023868; MGI:99685

Mapped Yes 
Amino Acid Change Arginine changed to Glutamine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000021750] [ENSMUSP00000127991] [ENSMUSP00000152510]
PDB Structure
X-ray crystallography-solution NMR hybrid structure of mouse RyR2 domain A [SOLUTION NMR]
Crystal structure of mouse Ryanodine Receptor 2 (residues 1-217) [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 mutant V186M [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 N-terminal domain (1-217) disease mutant A77V [X-RAY DIFFRACTION]
Structure of the first domain of a cardiac Ryanodine Receptor mutant with exon 3 deleted [X-RAY DIFFRACTION]
Crystal structure of mouse ryanodine receptor 2 (2699-2904) [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant P164S [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant R169Q [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant R176Q [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor isoform 2 (RyR2) 1-547 [X-RAY DIFFRACTION]
>> 3 additional structures at PDB <<
SMART Domains Protein: ENSMUSP00000021750
Gene: ENSMUSG00000021313
AA Change: R3614Q

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 454 648 3.1e-65 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 862 952 1.8e-36 PFAM
Pfam:RyR 976 1066 1.1e-32 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2122 2331 1.2e-71 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2700 2790 1.1e-33 PFAM
Pfam:RyR 2820 2904 7.1e-27 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3829 3947 3.1e-36 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.7e-96 PFAM
Pfam:Ion_trans 4710 4877 8e-16 PFAM
Predicted Effect possibly damaging

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
(Using ENSMUST00000021750)
SMART Domains Protein: ENSMUSP00000127991
Gene: ENSMUSG00000021313
AA Change: R3614Q

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 451 655 3.5e-73 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 861 955 1.4e-33 PFAM
Pfam:RyR 975 1069 9.2e-34 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2120 2331 3.9e-65 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2699 2793 1.1e-37 PFAM
Pfam:RyR 2819 2907 9.4e-34 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3825 3958 2.3e-42 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.1e-93 PFAM
Pfam:Ion_trans 4705 4865 9.3e-11 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000170156)
Predicted Effect unknown
Predicted Effect possibly damaging

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
(Using ENSMUST00000221527)
Phenotypic Category
Phenotypequestion? Literature verified References
Blood Pressure: HR Average - increased 11208676 22869620
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(56) : Gene trapped(27) Targeted(29)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Ryr2 APN 13 11834092 splice site probably benign
IGL00757:Ryr2 APN 13 11618604 splice site probably null
IGL00838:Ryr2 APN 13 11568503 missense probably damaging 0.98
IGL00849:Ryr2 APN 13 11585478 missense possibly damaging 0.91
IGL00987:Ryr2 APN 13 11735502 missense probably damaging 0.99
IGL01096:Ryr2 APN 13 11703544 missense probably damaging 1.00
IGL01313:Ryr2 APN 13 11638485 critical splice acceptor site probably null
IGL01349:Ryr2 APN 13 11587239 missense possibly damaging 0.93
IGL01391:Ryr2 APN 13 11556685 missense possibly damaging 0.96
IGL01401:Ryr2 APN 13 11591352 missense possibly damaging 0.80
IGL01412:Ryr2 APN 13 11742036 missense probably benign 0.10
IGL01419:Ryr2 APN 13 11799837 missense possibly damaging 0.51
IGL01432:Ryr2 APN 13 11851204 missense possibly damaging 0.63
IGL01533:Ryr2 APN 13 11721790 missense probably damaging 1.00
IGL01571:Ryr2 APN 13 11721761 missense probably damaging 1.00
IGL01584:Ryr2 APN 13 11601758 critical splice donor site probably null
IGL01611:Ryr2 APN 13 11591316 missense possibly damaging 0.67
IGL01632:Ryr2 APN 13 11594968 missense probably damaging 0.97
IGL01643:Ryr2 APN 13 11692677 missense possibly damaging 0.94
IGL01647:Ryr2 APN 13 11585480 missense probably damaging 1.00
IGL01730:Ryr2 APN 13 11601842 missense possibly damaging 0.86
IGL01834:Ryr2 APN 13 11595425 missense possibly damaging 0.71
IGL01921:Ryr2 APN 13 11554550 missense possibly damaging 0.96
IGL01937:Ryr2 APN 13 11790363 missense probably damaging 1.00
IGL01945:Ryr2 APN 13 11790363 missense probably damaging 1.00
IGL02027:Ryr2 APN 13 11597112 missense probably damaging 1.00
IGL02060:Ryr2 APN 13 11747564 missense probably damaging 1.00
IGL02065:Ryr2 APN 13 11572257 missense possibly damaging 0.92
IGL02084:Ryr2 APN 13 11792762 nonsense probably null
IGL02086:Ryr2 APN 13 11735556 missense probably damaging 1.00
IGL02095:Ryr2 APN 13 11759759 missense probably damaging 0.98
IGL02100:Ryr2 APN 13 11737873 missense possibly damaging 0.92
IGL02122:Ryr2 APN 13 11741869 missense probably damaging 1.00
IGL02202:Ryr2 APN 13 11730388 missense probably damaging 0.97
IGL02202:Ryr2 APN 13 11747658 splice site probably benign
IGL02369:Ryr2 APN 13 11619496 missense possibly damaging 0.68
IGL02383:Ryr2 APN 13 11722721 splice site probably benign
IGL02400:Ryr2 APN 13 11605244 splice site probably benign
IGL02423:Ryr2 APN 13 11745198 missense probably damaging 1.00
IGL02425:Ryr2 APN 13 11745674 missense probably damaging 0.99
IGL02458:Ryr2 APN 13 11705699 missense probably benign 0.15
IGL02602:Ryr2 APN 13 11554511 utr 3 prime probably benign
IGL02694:Ryr2 APN 13 11605189 missense probably damaging 1.00
IGL02726:Ryr2 APN 13 11738320 missense probably damaging 1.00
IGL02747:Ryr2 APN 13 11655677 missense probably damaging 1.00
IGL02795:Ryr2 APN 13 11595190 missense probably benign 0.21
IGL02876:Ryr2 APN 13 11707793 missense probably benign 0.39
IGL02878:Ryr2 APN 13 11918319 missense probably benign 0.10
IGL02887:Ryr2 APN 13 11591269 missense probably damaging 0.97
IGL02926:Ryr2 APN 13 11759835 missense probably damaging 0.99
IGL03030:Ryr2 APN 13 11684479 missense probably damaging 0.99
IGL03064:Ryr2 APN 13 11643902 critical splice acceptor site probably null
IGL03102:Ryr2 APN 13 11635582 splice site probably benign
IGL03152:Ryr2 APN 13 11853150 missense probably damaging 1.00
IGL03176:Ryr2 APN 13 11742023 nonsense probably null
IGL03180:Ryr2 APN 13 11568563 missense possibly damaging 0.95
IGL03213:Ryr2 APN 13 11724387 splice site probably benign
IGL03390:Ryr2 APN 13 11772416 missense probably benign
IGL03410:Ryr2 APN 13 11588147 missense probably damaging 0.99
arruda2 UTSW 13 11879496 missense probably damaging 1.00
arruda3 UTSW 13 11555448 missense possibly damaging 0.91
H8562:Ryr2 UTSW 13 11717141 splice site probably benign
IGL02799:Ryr2 UTSW 13 11665962 missense probably damaging 1.00
IGL02991:Ryr2 UTSW 13 11761306 missense probably damaging 0.99
PIT4142001:Ryr2 UTSW 13 11707796 missense probably damaging 0.97
R0003:Ryr2 UTSW 13 11824379 missense probably damaging 1.00
R0004:Ryr2 UTSW 13 11665919 missense probably benign
R0018:Ryr2 UTSW 13 11595223 missense possibly damaging 0.94
R0048:Ryr2 UTSW 13 11595784 missense probably damaging 1.00
R0048:Ryr2 UTSW 13 11595784 missense probably damaging 1.00
R0056:Ryr2 UTSW 13 11669038 missense probably damaging 0.97
R0062:Ryr2 UTSW 13 11869116 critical splice donor site probably null
R0062:Ryr2 UTSW 13 11869116 critical splice donor site probably null
R0080:Ryr2 UTSW 13 11568475 missense probably damaging 0.98
R0116:Ryr2 UTSW 13 11709921 missense probably damaging 1.00
R0148:Ryr2 UTSW 13 11714548 missense probably damaging 1.00
R0206:Ryr2 UTSW 13 11676251 splice site probably benign
R0226:Ryr2 UTSW 13 11772556 missense probably damaging 1.00
R0285:Ryr2 UTSW 13 11716977 missense probably damaging 1.00
R0365:Ryr2 UTSW 13 11668839 missense possibly damaging 0.90
R0401:Ryr2 UTSW 13 11705684 missense probably benign 0.45
R0415:Ryr2 UTSW 13 11869156 missense probably damaging 0.97
R0418:Ryr2 UTSW 13 11834095 splice site probably benign
R0558:Ryr2 UTSW 13 11638443 missense probably damaging 1.00
R0558:Ryr2 UTSW 13 11799861 missense probably damaging 1.00
R0574:Ryr2 UTSW 13 11731669 missense probably benign 0.02
R0586:Ryr2 UTSW 13 11635559 missense probably null
R0601:Ryr2 UTSW 13 11705633 critical splice donor site probably null
R0610:Ryr2 UTSW 13 11622952 missense probably damaging 1.00
R0648:Ryr2 UTSW 13 11724333 missense possibly damaging 0.86
R0727:Ryr2 UTSW 13 11566885 missense probably damaging 1.00
R0743:Ryr2 UTSW 13 11554529 missense probably damaging 0.99
R0821:Ryr2 UTSW 13 11738126 missense probably benign 0.35
R0884:Ryr2 UTSW 13 11554529 missense probably damaging 0.99
R1104:Ryr2 UTSW 13 11669969 missense probably damaging 0.99
R1114:Ryr2 UTSW 13 11945981 missense probably damaging 0.98
R1167:Ryr2 UTSW 13 11660113 missense possibly damaging 0.94
R1238:Ryr2 UTSW 13 11759703 missense probably damaging 1.00
R1239:Ryr2 UTSW 13 11883043 critical splice donor site probably null
R1296:Ryr2 UTSW 13 11687879 splice site probably benign
R1400:Ryr2 UTSW 13 11595076 missense probably benign 0.08
R1439:Ryr2 UTSW 13 11714503 splice site probably benign
R1443:Ryr2 UTSW 13 11779266 missense probably benign 0.19
R1446:Ryr2 UTSW 13 11738149 missense probably benign 0.09
R1458:Ryr2 UTSW 13 11727022 missense probably damaging 0.97
R1497:Ryr2 UTSW 13 11601841 missense probably damaging 0.99
R1505:Ryr2 UTSW 13 11554592 missense possibly damaging 0.84
R1548:Ryr2 UTSW 13 11554549 nonsense probably null
R1551:Ryr2 UTSW 13 11785143 critical splice acceptor site probably null
R1567:Ryr2 UTSW 13 11759677 missense possibly damaging 0.87
R1581:Ryr2 UTSW 13 11794563 missense probably benign 0.01
R1645:Ryr2 UTSW 13 11718482 nonsense probably null
R1686:Ryr2 UTSW 13 11603779 splice site probably benign
R1696:Ryr2 UTSW 13 11731657 missense probably benign 0.02
R1708:Ryr2 UTSW 13 11587442 splice site probably null
R1728:Ryr2 UTSW 13 11587422 missense possibly damaging 0.94
R1745:Ryr2 UTSW 13 11790267 missense probably damaging 1.00
R1771:Ryr2 UTSW 13 11745176 critical splice donor site probably null
R1776:Ryr2 UTSW 13 11745176 critical splice donor site probably null
R1783:Ryr2 UTSW 13 11700371 nonsense probably null
R1801:Ryr2 UTSW 13 11595281 missense probably benign 0.01
R1812:Ryr2 UTSW 13 11560586 missense probably damaging 0.97
R1820:Ryr2 UTSW 13 11587316 missense probably damaging 0.99
R1835:Ryr2 UTSW 13 11769878 missense probably benign 0.06
R1868:Ryr2 UTSW 13 11731700 missense probably benign 0.02
R1869:Ryr2 UTSW 13 11662075 missense probably damaging 0.98
R1884:Ryr2 UTSW 13 11738356 missense probably damaging 0.97
R1892:Ryr2 UTSW 13 11658958 nonsense probably null
R1897:Ryr2 UTSW 13 11750932 missense probably benign 0.09
R1899:Ryr2 UTSW 13 11591336 missense probably benign
R1909:Ryr2 UTSW 13 11700349 missense probably damaging 1.00
R1918:Ryr2 UTSW 13 11556698 missense possibly damaging 0.91
R1937:Ryr2 UTSW 13 11668962 missense probably damaging 1.00
R1943:Ryr2 UTSW 13 11731723 missense probably benign 0.10
R1956:Ryr2 UTSW 13 11681080 missense probably damaging 1.00
R1983:Ryr2 UTSW 13 11585402 splice site probably null
R2018:Ryr2 UTSW 13 11851188 missense possibly damaging 0.59
R2019:Ryr2 UTSW 13 11851188 missense possibly damaging 0.59
R2060:Ryr2 UTSW 13 11595736 missense probably damaging 1.00
R2061:Ryr2 UTSW 13 11665878 splice site probably null
R2088:Ryr2 UTSW 13 11662229 missense probably benign 0.04
R2089:Ryr2 UTSW 13 11945977 missense probably benign 0.23
R2091:Ryr2 UTSW 13 11945977 missense probably benign 0.23
R2091:Ryr2 UTSW 13 11945977 missense probably benign 0.23
R2127:Ryr2 UTSW 13 11712195 missense probably damaging 1.00
R2140:Ryr2 UTSW 13 11560607 missense probably damaging 1.00
R2153:Ryr2 UTSW 13 11577873 missense possibly damaging 0.86
R2179:Ryr2 UTSW 13 11705793 nonsense probably null
R2207:Ryr2 UTSW 13 11810937 missense probably damaging 1.00
R2237:Ryr2 UTSW 13 11662260 missense probably benign 0.18
R2258:Ryr2 UTSW 13 11738216 missense possibly damaging 0.94
R2312:Ryr2 UTSW 13 11738242 missense probably damaging 1.00
R2421:Ryr2 UTSW 13 11591237 missense probably damaging 0.98
R2438:Ryr2 UTSW 13 11801848 missense probably damaging 1.00
R2483:Ryr2 UTSW 13 11759703 missense probably damaging 1.00
R2860:Ryr2 UTSW 13 11593093 missense probably damaging 0.98
R2861:Ryr2 UTSW 13 11593093 missense probably damaging 0.98
R2867:Ryr2 UTSW 13 11761349 missense probably damaging 1.00
R2867:Ryr2 UTSW 13 11761349 missense probably damaging 1.00
R3618:Ryr2 UTSW 13 11772580 critical splice acceptor site probably null
R3876:Ryr2 UTSW 13 11588159 missense probably damaging 0.99
R3906:Ryr2 UTSW 13 11738209 missense possibly damaging 0.87
R3912:Ryr2 UTSW 13 11772427 missense probably damaging 0.99
R4018:Ryr2 UTSW 13 11918414 missense probably damaging 1.00
R4114:Ryr2 UTSW 13 11692682 missense probably damaging 1.00
R4119:Ryr2 UTSW 13 11779267 missense probably benign 0.22
R4127:Ryr2 UTSW 13 11587437 missense possibly damaging 0.91
R4222:Ryr2 UTSW 13 11737873 missense possibly damaging 0.92
R4233:Ryr2 UTSW 13 11750725 missense probably benign 0.20
R4355:Ryr2 UTSW 13 11649812 missense probably benign 0.05
R4384:Ryr2 UTSW 13 11605233 missense probably damaging 0.99
R4422:Ryr2 UTSW 13 11717066 nonsense probably null
R4430:Ryr2 UTSW 13 11735527 missense probably damaging 0.98
R4624:Ryr2 UTSW 13 12106415 missense possibly damaging 0.47
R4663:Ryr2 UTSW 13 11749509 missense possibly damaging 0.47
R4665:Ryr2 UTSW 13 11750685 splice site probably null
R4668:Ryr2 UTSW 13 11593117 missense probably benign
R4677:Ryr2 UTSW 13 11706667 missense probably damaging 0.98
R4679:Ryr2 UTSW 13 11824369 missense probably benign 0.34
R4680:Ryr2 UTSW 13 11595233 missense probably benign 0.04
R4685:Ryr2 UTSW 13 11692646 missense probably damaging 1.00
R4709:Ryr2 UTSW 13 11716998 missense probably damaging 1.00
R4731:Ryr2 UTSW 13 11577909 missense possibly damaging 0.53
R4732:Ryr2 UTSW 13 11577909 missense possibly damaging 0.53
R4733:Ryr2 UTSW 13 11577909 missense possibly damaging 0.53
R4734:Ryr2 UTSW 13 11737753 missense probably damaging 0.99
R4740:Ryr2 UTSW 13 11657047 missense possibly damaging 0.95
R4801:Ryr2 UTSW 13 11708227 missense probably damaging 1.00
R4801:Ryr2 UTSW 13 11687932 missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11687932 missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11708227 missense probably damaging 1.00
R4804:Ryr2 UTSW 13 11717097 missense probably damaging 1.00
R4811:Ryr2 UTSW 13 11655698 missense probably damaging 0.97
R4850:Ryr2 UTSW 13 11668820 missense probably damaging 0.99
R4850:Ryr2 UTSW 13 11745752 missense probably damaging 1.00
R4880:Ryr2 UTSW 13 11752218 missense probably damaging 1.00
R4917:Ryr2 UTSW 13 11594986 missense probably damaging 0.96
R4918:Ryr2 UTSW 13 11594986 missense probably damaging 0.96
R4922:Ryr2 UTSW 13 11709963 missense probably damaging 0.99
R4933:Ryr2 UTSW 13 11945945 missense probably damaging 0.96
R4950:Ryr2 UTSW 13 11742011 missense probably damaging 1.00
R4957:Ryr2 UTSW 13 11785080 missense probably damaging 0.97
R4964:Ryr2 UTSW 13 11714611 missense possibly damaging 0.49
R4964:Ryr2 UTSW 13 11833992 missense probably benign 0.00
R4966:Ryr2 UTSW 13 11714611 missense possibly damaging 0.49
R4966:Ryr2 UTSW 13 11833992 missense probably benign 0.00
R4997:Ryr2 UTSW 13 11595306 missense probably benign 0.09
R4998:Ryr2 UTSW 13 11643895 missense probably damaging 1.00
R5033:Ryr2 UTSW 13 11587254 missense possibly damaging 0.93
R5061:Ryr2 UTSW 13 11635536 missense possibly damaging 0.74
R5062:Ryr2 UTSW 13 11700354 missense probably damaging 0.97
R5088:Ryr2 UTSW 13 11712243 nonsense probably null
R5135:Ryr2 UTSW 13 11662130 missense probably benign 0.05
R5138:Ryr2 UTSW 13 11660289 missense probably damaging 1.00
R5168:Ryr2 UTSW 13 11752321 missense probably benign
R5187:Ryr2 UTSW 13 11772452 missense probably damaging 0.99
R5197:Ryr2 UTSW 13 11638430 critical splice donor site probably null
R5262:Ryr2 UTSW 13 11772437 missense probably damaging 0.99
R5325:Ryr2 UTSW 13 11690363 missense probably damaging 0.97
R5381:Ryr2 UTSW 13 11556658 missense probably damaging 1.00
R5437:Ryr2 UTSW 13 11655713 missense probably damaging 1.00
R5477:Ryr2 UTSW 13 11705656 missense probably damaging 1.00
R5497:Ryr2 UTSW 13 11705701 missense probably null 0.15
R5509:Ryr2 UTSW 13 11745601 missense probably damaging 0.98
R5518:Ryr2 UTSW 13 11687909 missense probably benign 0.01
R5571:Ryr2 UTSW 13 11555448 missense possibly damaging 0.91
R5591:Ryr2 UTSW 13 11595014 missense probably benign 0.06
R5619:Ryr2 UTSW 13 11708202 missense probably damaging 1.00
R5630:Ryr2 UTSW 13 11601805 missense probably damaging 1.00
R5644:Ryr2 UTSW 13 11595582 missense probably damaging 0.99
R5667:Ryr2 UTSW 13 11759836 missense probably damaging 1.00
R5775:Ryr2 UTSW 13 11769962 missense probably damaging 1.00
R5836:Ryr2 UTSW 13 11603732 missense probably damaging 1.00
R5858:Ryr2 UTSW 13 11560574 missense probably damaging 0.99
R5934:Ryr2 UTSW 13 11584154 missense probably damaging 0.96
R5939:Ryr2 UTSW 13 11790332 missense probably damaging 0.99
R5941:Ryr2 UTSW 13 11687902 missense probably damaging 1.00
R5945:Ryr2 UTSW 13 11660122 missense probably damaging 1.00
R5946:Ryr2 UTSW 13 11726953 missense probably damaging 1.00
R5966:Ryr2 UTSW 13 11662238 nonsense probably null
R5974:Ryr2 UTSW 13 11714511 splice site probably null
R6104:Ryr2 UTSW 13 11799825 missense probably damaging 1.00
R6118:Ryr2 UTSW 13 11792689 missense possibly damaging 0.69
R6149:Ryr2 UTSW 13 11669017 missense probably benign
R6208:Ryr2 UTSW 13 11895220 missense probably benign 0.04
R6217:Ryr2 UTSW 13 11834078 missense probably damaging 1.00
R6230:Ryr2 UTSW 13 11660107 missense probably damaging 0.99
R6279:Ryr2 UTSW 13 11680999 missense probably damaging 0.97
R6294:Ryr2 UTSW 13 11879496 missense probably damaging 1.00
R6300:Ryr2 UTSW 13 11680999 missense probably damaging 0.97
R6350:Ryr2 UTSW 13 11761396 missense probably damaging 0.98
R6484:Ryr2 UTSW 13 11662383 missense possibly damaging 0.90
R6489:Ryr2 UTSW 13 11834007 missense probably benign 0.29
R6548:Ryr2 UTSW 13 11668821 missense probably damaging 1.00
R6590:Ryr2 UTSW 13 11594723 missense probably benign 0.01
R6623:Ryr2 UTSW 13 11710065 missense probably damaging 1.00
R6649:Ryr2 UTSW 13 11595643 missense probably damaging 0.99
R6691:Ryr2 UTSW 13 11594723 missense probably benign 0.01
R6770:Ryr2 UTSW 13 11738462 missense probably damaging 1.00
R6802:Ryr2 UTSW 13 11686966 missense probably damaging 1.00
R6809:Ryr2 UTSW 13 11726930 missense probably damaging 1.00
R6893:Ryr2 UTSW 13 11829654 missense possibly damaging 0.75
R6911:Ryr2 UTSW 13 11827559 missense possibly damaging 0.50
R6915:Ryr2 UTSW 13 11745601 missense probably damaging 1.00
R6943:Ryr2 UTSW 13 11566948 missense possibly damaging 0.92
R6960:Ryr2 UTSW 13 11801243 missense probably benign 0.28
S24628:Ryr2 UTSW 13 11869156 missense probably damaging 0.97
X0019:Ryr2 UTSW 13 11703501 missense probably benign 0.04
Mode of Inheritance Autosomal Semidominant
Local Stock
Repository
Last Updated 2018-10-24 2:12 PM by Anne Murray
Record Created 2017-03-07 3:29 PM
Record Posted 2018-10-24
Phenotypic Description

Figure 1. Arruda mice exhibited increased average heart rates. TNormalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Arruda phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4998, some of which showed an increase in the average heart rate (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased heart rate phenotype using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 92 mutations (X-axis) identified in the G1 male of pedigree R4998. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 92 mutations. The heart rate phenotype was linked by continuous variable mapping to a mutation in Ryr2: a G to A transition at base pair 11,643,895 (v38) on chromosome 13, or base pair 463,051 in the GenBank genomic region NC_000079 encoding Ryr2.  Linkage was found with an additive model of inheritance, wherein eight variant homozygotes and 23 heterozygous mice departed phenotypically from 20 homozygous reference mice with a P value of 3.858 x 10-5 (Figure 2).  

 

The mutation corresponds to residue 11,340 in the mRNA sequence NM_023868 within exon 77 of 105 total exons.

 

11324 AATCTGCCAAGGCATCGGGCGGTCAATCTTTTT

3609  -N--L--P--R--H--R--A--V--N--L--F-

 

The mutated nucleotide is indicated in red.  The mutation results in an arginine (R) to glutamine (Q) substitution at position 3,614 (R3614Q) in the Ryr2 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.491).

 

Protein Prediction
Figure 3. Domain and topology of RYR2. A. Domain organization of RYR2. Please see the text for more information about the domains shown. The Arruda mutation results in an arginine to glutamine substitution at position 3,614. B. Topology of RYR2. Two monomers of the RYR homotetramer are shown. NTD, N-terminal domain; SPRY, SpIa and RYR; MIR, mannosyltransferase, inositol 1,4,5-trisphosphate receptor, and RYR; LZ, leucine zipper; EF, EF hand domain; TM, transmembrane; PF, pore-forming; CTD, C-terminal domain. This image in interactive. Other mutations found in the RYR2 protein are noted in red. Click on each mutation for more information.
Figure 4. Cryo-EM structure of RYR2 in open state. Each monomer in the homotetramer is colored individually. UCSF Chimera model is based on PDB 5GOA, Peng et al. Science354 (2016). Click on the 3D structure to view it rotate.

Ryr2 encodes cardiac ryanodine receptor 2 (RYR2), one of three RYRs (i.e., RYR1, RYR2, and RYR3). RYR1 is the major RYR form found in skeletal muscle (1), RYR2 is the major form in cardiac muscle, and RYR3 is more widely expressed with high levels in the brain; the function of RYR3 is unknown (2). The three isoforms share approximately 66% sequence identity, but each RYR exhibits different Ca2+ binding affinities with RyR1  >  RyR2  > RyR3.

 

Functional RYRs are homotetramers that form a pore. Each monomer has a large cytoplasmic N-terminal tail, six transmembrane domains, and a short C-terminal tail (Figure 3). The cytoplasmic tail of RYR2 consists of an N-terminal domain (NTD), three SPRY (SpIa and RYR) domains, four armadillo repeat-containing domains (termed the Handle domain), five MIR (Mannosyltransferase, Inositol 1,4,5-trisphosphate receptor, and Ryanodine receptor) domains, two RYR domains (alternatively P1 and P2 domains), three leucine zippers, and two putative EF-hand motifs (3-7). The NTD contains three subdomains: A (alternatively, Pfam domain: Ins145_P3_rec; amino acids 1 to 217), B (alternatively, Pfam domain: MIR; amino acids 218 to 409), and C (alternatively, Pfam domain: RIH; amino acids 410 to 543) (6;8). Overall, the NTD is not required for channel gating (7); however, subdomain A is involved in channel termination, subdomain B functions in channel suppression, and subdomain C functions in channel activation and RYR2 expression (7). SPRY domains are found in members of the immunoglobulin superfamily; the function of SPRY domains is unknown. MIR domains are found in protein O-mannosyltransferases, inositol trisphosphate receptors, and RYR proteins. The MIR domains putatively participate in the structure of the clamp domain (9). The P1 domain is a component of the clamp, while the P2 domain contains the Ser2808 and Ser2814 phosphorylation sites. The leucine zippers function as specific anchoring sites for muscle A-kinase-anchoring protein (mAKAP), spinophilin, and PR130, which regulates RYR2 phosphorylation (10). The EF-hand motifs mediate Ca2+ binding and contribute to Ca2+ modulation of the RYR1 channel (11). In RYR2, the EF-hand motifs are not required for cytosolic Ca2+ modulation of the RYR2 channel, but are required for luminal Ca2+ modulation of the RYR2 channel and for store overload-induced Ca2+ release (12). The luminal loops within the transmembrane domain region of the RYR2 monomers contribute to the pore structure and amino acids Glu4832, Ile4829, Gly4826, and Gln4881 (rabbit RYR2) directly mediate Ca2+ passage through the pore (13-15). The last 15 amino acids of the C-terminal tail are putatively required for tetramer formation (16). A second study proposed that the tetramerization domain was between amino acids 4869 and 5019 in RyR1 (17).

 

Single-particle electron microscopy (EM) of stained and unstained frozen-hydrated RYR2 showed a four-fold symmetric mushroom-shaped architecture, with the four copies of the cytosolic domain forming an umbrella, and a small cylindric transmembrane domain containing the pore [Figure 4; PDB: 5GOA; (18;19). Later studies using high-resolution cryo-EM showed that RYR1 (and RYR2) has an insertion between the S2 and S3 helices (S2S3 domain), a 90 Å long pore helix ending with a C-terminal domain containing a zinc finger and an acidic disordered loop between S1 and S2 (20). The activation domain contains a domain in the shape of a thumb and forefingers, which clamps the zinc finger-containing C-terminal domain. RYRs are principally composed of three α-solenoid repeats. The core solenoid (CSol) is part of the activation domain, and links the pore domain to the shell. The bridging (BSol) and N-terminal solenoids (NSol) are joined by the junctional solenoid (JSol) (21). The RYRs are closed at low levels of cytosolic Ca2+ ([Ca2+] ~100–200 nM). Increased levels of cytosolic Ca2+ ([Ca2+]cyto ~10 μM) stimulate channel opening. RYR2 undergoes conformational changes when opening, including expansion of the clamp domain, rotation of the transmembrane domains relative to the cytoplasmic region, and expansion of the pore to 18 Å (15;22;23).

 

RYR2 is phosphorylated at Ser2808, Ser2814, and Ser2030. Other sites (e.g., Thr2876, Thr2781, Tyr2821, and Ser2822) can also be putatively phosphorylated by protein kinase A (PKA). Ser2808 can be phosphorylated by both PKA and Ca2+/calmodulin-dependent protein kinase II (CaMKII) (24;25). High basal levels of Ser2808 phosphorylation is important for normal excitation–contraction coupling (26-28). CamKII phosphorylates Ser2814, which increases the Ca2+ sensitivity and open probability (Po) of RYR2 (29-31). Ser2030 is phosphorylated by PKA and protein kinase G (but not CaMKII) (32;33). Ser2030 phosphorylation affects RYR2 sensitivity during b-adrenergic stimulation. For more information on the effects of RYR2 phosphorylation, see Table 1 and Table 2 (in the Background section).

 

RYRs interact with several ligands that putatively regulate gating of the channel, including ions (primarily Ca2+ and Mg2+), the voltage-gated Ca2+ channel, and small molecules (e.g., adenine nucleotides and caffeine) (21). RYR2 also serves as a scaffold for several regulatory subunits and enzymes (Table 1).

 

Table 1. RYR2-associated regulatory proteins

RYR2 interacting region

Regulatory protein

Description

RYR2-associated function

References

Cytoplasmic N-terminus

FKBP12.6 (alternatively, calstabin2) and FKBP12 (putatively species specific)

Immunophilins and FK-506 binding proteins

Stabilizes the closed state of the channel and prevents the pathological leak of Ca2+

(34-37)

Calmodulin

Ca2+-binding protein

Inhibits RYR2 at [Ca2+] < 10 μM; assists RYR2 closing after sarcoplasmic reticulum Ca2+ release in EC-coupling

(38-41)

CaMKII

Kinase

Phosphorylates Ser2815 (Ser2814 in mouse), which sensitizes the channel to cytosolic Ca2+

(10;42;43)

PKA

Kinase

Phosphorylates Ser2809 (Ser2808 in mouse) and Ser2030, which activates the channel by increasing the sensitivity of RyR2 to cytosolic Ca2+ and promoting dissociation from FKBP12.6

(26;42;44)

3′,5′-cyclic phosphodiesterase 4D (pDE4D)

cAMP-specific enzyme

Provides negative-feedback mechanism to limit phosphorylation of RyR2-Ser2808

(45)

mAKAP

Scaffold protein

Targets PKA and pDE4D to RYR2

 

(46;47)

Sorcin

Ca2+-binding protein

Reduces the Po

of RYR2

(48;49)

Spinophilin and PR130

Spinophilin: PP1 regulatory subunit; PR130: PP2A regulatory subunit

Target the protein phosphatases PP1 and PP2A to RyR2

(10)

PP1 (anchored by spinophilin) and PP2A (anchored by PR130)

Phosphatases

Regulates channel activity

(10;42)

C-terminus

Calsequestrin

Ca2+-binding protein which sequesters Ca2+ in the sarcoplasmic reticulum

Regulates RYR2 activity

(50)

Triadin

Integral sarcoplasmic reticulum membrane protein

Necessary for proper orientation and activity of the RYR-L-type Ca2+ channel Ca2+ release unit; links calsequestrin to RYR2

(51)

Junctin

Integral sarcoplasmic reticulum membrane protein

Stabilizes RYR2 in the myocardium

 

(52)

 

Ryr2 is alternatively spliced (removing exons 4 [corresponding to amino acids 92 to 98 in human RYR2] and 75 [corresponding to amino acids 3564 to 3575 in human RYR2]) to generate a mRNA that is predominantly expressed in pancreatic islets, cerebrum, and cerebellum (53). HEK293 cells transfected with the “islet-type” RYR2 expression vector showed increased Ca2+ release after treatment with cyclic ADP-ribose (stimulates intracellular Ca2+ mobilization) compared to cells transfected with a canonical RYR2 expression vector (53). Two additional alternatively spliced variants with 30- and 24-base pair insertions have been identified in humans (54). The two variants were expressed in cardiomyocytes and localized to the sarcoplasmic reticulum, perinuclear Golgi apparatus, and invaginations of the nuclear envelope (nucleoplasmic reticulum). The 24-base pair variant was required for RYR2 targeting to the intranuclear Golgi apparatus. Expression of the 30- and 24-base pair splice variants resulted in reduced amplitude variability of nuclear and cytoplasmic Ca2+ fluxes in nonstimulated cardiomyocytes as well as lower basal levels of apoptosis (54). Expression of the 24-base pair variant suppressed intracellular Ca2+ fluxes following prolonged caffeine exposure that protected cells from apoptosis. The 30-base pair variant did not protect cardiomyocytes from caffeine-evoked apoptosis.

 

The Arruda mutation results in an arginine (R) to glutamine (Q) substitution at position 3,614 (R3614Q); Arg3614 is within an undefined region between the last leucine zipper and the first EF-hand motif.

Expression/Localization

RYR2 is expressed in cardiomyocytes, pancreatic islets, and the dentate gyrus of the hippocampus (31;55). RYR2 localizes to the membrane of the sarcoplasmic reticulum.

Background
Figure 5. RYR2 function in cardiac myocyte contraction. In cardiac muscle, depolarization of the plasma membrane activates Ca2+ influx via Cav1.2, triggering Ca2+ release from the sarcoplasmic reticulum via RyR2 channels. The accessory proteins indicated in the purple bubble bind each RYR2 monomer. Triadin, junctin, and calsequestrin (CSQ) bind at the luminal SR surface to ryanodine receptors. See Table 1 for more information about RYR2 accessory proteins. The resulting release of calcium leads to a transitory increase in intracellular Ca2+ that binds to troponin C, enabling myocardial contraction.

Ca2+ signaling is essential for development, proliferation, neuronal transmission, learning and memory, muscle contraction, cell motility, cell growth, and cell death as well as regulation of enzyme activity, permeability of ion channels, and activity of ion pumps [reviewed in (56)]. RYR2-associated Ca2+ release is required for cardiac muscle excitation-contraction coupling [(57;58); reviewed in (59)]. In cardiac muscle, depolarization of the plasma membrane activates Ca2+ influx via the L-type Ca2+ channel (Cav1.2; see the record hera for more information about voltage-dependent calcium channels), which subsequently activates RYR2 (Figure 5) (60). Calcium sensors within RYR2 bind calcium and facilitate opening of the channel, resulting in release of calcium from the sarcoplasmic reticulum via the Ca2+-induced Ca2+-release (CICR) mechanism (59;61). The CICR mechanism causes a transitory increase in intracellular Ca2+ that binds to troponin C, enabling actin-myosin binding and signaling contractile myofilaments to generate force, sarcomere shortening, and myocardial contraction. Termination of sarcoplasmic reticulum Ca2+ release promotes relaxation. During relaxation, Ca2+ returns to diastolic Ca2+ levels via the activity of sarco(endo)plasmic reticulum Ca2+-ATPase (SERCA)2a and the sarcolemma Na+/Ca2+ exchanger (NCX) [reviewed in (62)].

 

RYR2 also functions in cognitive function (63) and insulin secretion (64). Ca2+ signaling regulates insulin secretion from the islets of Langerhans. Insulin secretion largely depends on voltage-activated Ca2+ influx, and RYR2 regulates β cell insulin release and glucose homeostasis (64). Mutations that are linked to aberrant RYR2 function in cardiac myocytes also cause impaired glucose homeostasis, activation of the ER stress response, and fuel-stimulated insulin release (64).

 

Mutations in RYR2 are linked to arrhythmogenic right ventricular dysplasia 2 [ARVD2; OMIM: #600996; (65;66)] and catecholaminergic polymorphic ventricular tachycardia 1 [CPVT1; OMIM: #604772; (67;68)]. ARVD2 is characterized by partial degeneration of the myocardium of the right ventricle, effort-induced polymorphic ventricular tachycardias, and sudden death. CPVT1 is characterized by a reproducible form of polymorphic ventricular tachycardia induced by physical activity, stress, or catecholamine infusion, which can deteriorate into ventricular fibrillation. Patients exhibit recurrent syncope, seizures, or sudden death after physical activity or emotional stress; the heart is morphologically normal.

 

Several mouse Ryr2 mutant mouse strains have been generated and characterized (Table 2). Most mutant mice showed heart rhythm abnormalities due to aberrant channel function, and some mutations resulted in sudden death of the mouse.

 

Table 2. Phenotypes of RYR2 mutant mice

Mutation

Mutation note

Phenotype (homozygous)

References

Ryr2-/-

Removed the first protein coding sequence of 48 base pairs and part of the first intron

 

Embryonic lethality (~E10.5), abnormal cardiomyocyte morphology, abnormal myocardial trabeculae morphology, disorganized myocardium, abnormal epicardium morphology, and embryonic growth retardation

(69) & MGI

Ryr2flox/ Ryr2flox

A1cfTg(Myh6-cre/Esr1*)1Jmk/0

Inducible, cardiac-specific RYR2 knockout

Bradycardia, arrhythmia, lethargy sudden death

 

(70)

RYR2 Ex3-del (exon 3 deletion)

Mimics human CPVT1 mutation

Embryonic lethal; heterozygous cardiomyocytes showed increased time-to-peak and time-to-50% decay of calcium release evoked by depolarization

(71)

R176Q

ARVD2

Reduced right ventricular end-diastolic volume, and the mice showed ventricular tachycardia after caffeine and epinephrine injection

(72;73)

L433P

Mimics human CPVT1 mutation

Atrial fibrillation, leaky calcium channels in the sarcoplasmic reticulum of atrial myocytes

(74)

R420W

ARVD2

Increased thymus and spleen weights as well as increased lymphocytic density in the spleen; heart morphology was normal

(75)

S2246L*

Mimics human CPVT1 mutation

Ventricular tachycardia; cardiomyocytes exhibit reduced threshold of sarcoplasmic reticulum calcium load for channel activation

(76)

P2328S

Mimics human CPVT1 mutation

Ventricular tachycardia

(77)

R2386I*

Mimics human CPVT1 mutation

Atrial fibrillation and leaky calcium channels in the sarcoplasmic reticulum of atrial myocytes

 

R2474S

Mimics human CPVT1 mutation

Spontaneous generalized tonic-clonic seizures (in the absence of cardiac arrhythmias), exercise-induced ventricular arrhythmias, and sudden death

(78)

V2475F

Mimics human CPVT1 mutation

Embryonic lethality (~E9); heterozygous mice showed normal cardiac morphology and functional echocardiogram at rest, but irregular heartbeats after beta-adrenergic stimulation

(79)

S2080A

PKA phosphorylation mutant

In the absence of induced myocardial infarction, the morphology of homozygous hearts is similar to wild-type; less susceptibility to myocardial infarction-induced heart failure; cardiomyocytes showed slower time constant of decay for calcium transients

(26-28)

S2814A

CaMKII phosphorylation mutant

Ventricular tachycardia; increased response of heart to induced stress

(73;80)

S2814D

CaMKII phosphorylation mutant

Reduced cardiac muscle contractility, reduced heart rate and ventricular tachycardia after treatment with caffeine and epinephrine, increased response of the heart to induced stress

(80)

W3587A/L3591AD/F3603A

In exon 75, which encodes the CaM-binding site of RyR2

 

Postnatal lethality (P9), enlarged hearts, cardiac fibrosis, reduced ventricle muscle contractility, reduced heart rates, reduced body weights, thin interventricular septum

(81)

L3591D

Eliminates CaM and S100A1 inhibition

Increased heart weight, thick interventricular septum, cardiac hypertrophy

(82)

R4496C

Mimics human CPVT1 mutation

Increase in RYR2 channel activity, ventricular fibrillation, ventricular tachycardia, and enhanced RYR2 sensitivity to Ca2+ and caffeine

(83;84)

A4860G

Mimics human CPVT1 mutation

Prenatal lethality; heterozygotes showed reduced heart rate and ventricular fibrillation

(85)

E4872Q

E4872 is an element of the RYR2 luminal Ca2+ sensing mechanism

Embryonic lethality (~E10.5); heterozygous mice are resistant to store overload-induced Ca2+ waves and completely protected against Ca2+-triggered ventricular tachycardia

(86)

* Studied in heterozygous mice only

Putative Mechanism

The phenotype of the Arruda mice indicates loss of RYR2-associated function.

Primers PCR Primer
Arruda(F):5'- GTCATAACCAGTAAATGTGGCAAC -3'
Arruda(R):5'- ACCCAAAGTCAGTATGTGATCTGAG -3'

Sequencing Primer
Arruda_seq(F):5'- GGCAACAGTGAGAATTAAAGTTTTC -3'
Arruda_seq(R):5'- GTCAGTATGTGATCTGAGAAAACTGC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsSamantha Teixeira and Bruce Beutler