Incidental Mutation 'R7698:Ryr2'
ID 593801
Institutional Source Beutler Lab
Gene Symbol Ryr2
Ensembl Gene ENSMUSG00000021313
Gene Name ryanodine receptor 2, cardiac
Synonyms 9330127I20Rik
MMRRC Submission 045759-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7698 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 11553102-12106945 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 11761315 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1112 (D1112G)
Ref Sequence ENSEMBL: ENSMUSP00000021750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021750] [ENSMUST00000170156]
AlphaFold no structure available at present
PDB Structure X-ray crystallography-solution NMR hybrid structure of mouse RyR2 domain A [SOLUTION NMR]
Crystal structure of mouse Ryanodine Receptor 2 (residues 1-217) [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 mutant V186M [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 N-terminal domain (1-217) disease mutant A77V [X-RAY DIFFRACTION]
Structure of the first domain of a cardiac Ryanodine Receptor mutant with exon 3 deleted [X-RAY DIFFRACTION]
Crystal structure of mouse ryanodine receptor 2 (2699-2904) [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant P164S [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant R169Q [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant R176Q [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor isoform 2 (RyR2) 1-547 [X-RAY DIFFRACTION]
>> 3 additional structures at PDB <<
Predicted Effect possibly damaging
Transcript: ENSMUST00000021750
AA Change: D1112G

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021750
Gene: ENSMUSG00000021313
AA Change: D1112G

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 454 648 3.1e-65 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 862 952 1.8e-36 PFAM
Pfam:RyR 976 1066 1.1e-32 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2122 2331 1.2e-71 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2700 2790 1.1e-33 PFAM
Pfam:RyR 2820 2904 7.1e-27 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3829 3947 3.1e-36 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.7e-96 PFAM
Pfam:Ion_trans 4710 4877 8e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170156
AA Change: D1112G

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127991
Gene: ENSMUSG00000021313
AA Change: D1112G

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 451 655 3.5e-73 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 861 955 1.4e-33 PFAM
Pfam:RyR 975 1069 9.2e-34 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2120 2331 3.9e-65 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2699 2793 1.1e-37 PFAM
Pfam:RyR 2819 2907 9.4e-34 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3825 3958 2.3e-42 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.1e-93 PFAM
Pfam:Ion_trans 4705 4865 9.3e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype Strain: 3640298
Lethality: E9-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show embryonic lethality during organogenesis and altered cardiomyocyte morphology. Homozygotes for a phosphorylation defective allele show decreased susceptibility to myocardial infarction-induced heart failure. Homozygotes for the R420W allele show lymphoid organ hypertrophy. [provided by MGI curators]
Allele List at MGI

All alleles(44) : Targeted(17) Gene trapped(27)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T G 1: 37,625,371 (GRCm38) E482A probably benign Het
A630023A22Rik C A 14: 34,052,613 (GRCm38) L140F unknown Het
Actn1 T C 12: 80,174,537 (GRCm38) T581A probably benign Het
AI314180 C G 4: 58,832,660 (GRCm38) C900S unknown Het
Ak9 T C 10: 41,348,076 (GRCm38) L495S Het
Aldh5a1 T C 13: 24,911,748 (GRCm38) D462G probably damaging Het
Amz2 A G 11: 109,429,007 (GRCm38) D73G probably damaging Het
Ank2 A G 3: 127,032,211 (GRCm38) Y361H probably benign Het
Atp8b1 A G 18: 64,571,022 (GRCm38) Y342H probably benign Het
Atp8b5 C T 4: 43,366,735 (GRCm38) T833I probably benign Het
Camkk2 A G 5: 122,746,419 (GRCm38) I313T probably damaging Het
Cdk18 T C 1: 132,122,378 (GRCm38) T20A probably damaging Het
Cenpf A T 1: 189,662,072 (GRCm38) C479S probably benign Het
Cfap221 C A 1: 119,961,929 (GRCm38) E192* probably null Het
Cfap44 C T 16: 44,433,786 (GRCm38) H958Y probably damaging Het
Cic A T 7: 25,273,172 (GRCm38) Q776L possibly damaging Het
Cldn17 C A 16: 88,506,356 (GRCm38) G162* probably null Het
Col19a1 T A 1: 24,312,078 (GRCm38) Y748F probably benign Het
Col27a1 C T 4: 63,225,718 (GRCm38) P548S possibly damaging Het
Ctsr T A 13: 61,162,567 (GRCm38) M92L probably benign Het
Cyp2d12 T C 15: 82,558,970 (GRCm38) V360A probably benign Het
Defa34 G T 8: 21,666,629 (GRCm38) C91F probably damaging Het
Dennd2c G A 3: 103,165,043 (GRCm38) V815I possibly damaging Het
Dlgap4 C T 2: 156,749,095 (GRCm38) Q734* probably null Het
Dph1 A T 11: 75,190,441 (GRCm38) S7T probably benign Het
Dpp8 T C 9: 65,042,336 (GRCm38) V121A probably benign Het
Dst G A 1: 34,190,387 (GRCm38) G2354S probably benign Het
Duox2 A T 2: 122,280,764 (GRCm38) L1453Q probably damaging Het
Exosc10 T A 4: 148,558,498 (GRCm38) S11T probably benign Het
Fetub A G 16: 22,939,309 (GRCm38) T281A probably benign Het
Flii A T 11: 60,720,092 (GRCm38) W504R probably damaging Het
Gm17727 T C 9: 35,777,176 (GRCm38) M38V probably benign Het
Gm5093 T C 17: 46,439,940 (GRCm38) R54G possibly damaging Het
Gmcl1 T C 6: 86,707,415 (GRCm38) D375G probably benign Het
Hikeshi A T 7: 89,923,681 (GRCm38) N101K probably benign Het
Hmcn2 T C 2: 31,423,153 (GRCm38) V3458A probably damaging Het
Hspa2 A G 12: 76,405,309 (GRCm38) N259S possibly damaging Het
Irf6 T C 1: 193,161,767 (GRCm38) I110T probably damaging Het
Kcnj8 T A 6: 142,565,753 (GRCm38) H376L probably damaging Het
Kdm6b G A 11: 69,405,981 (GRCm38) P487S probably benign Het
Lcp1 C A 14: 75,206,211 (GRCm38) Y222* probably null Het
Manea T C 4: 26,327,763 (GRCm38) D426G probably damaging Het
Map3k20 G T 2: 72,364,681 (GRCm38) E101* probably null Het
Map3k20 C G 2: 72,438,314 (GRCm38) S555C probably benign Het
Mtmr7 G A 8: 40,606,884 (GRCm38) A62V possibly damaging Het
Myo6 C T 9: 80,217,656 (GRCm38) P6S unknown Het
Myoc A T 1: 162,639,445 (GRCm38) Q61L probably damaging Het
N4bp2 T A 5: 65,808,157 (GRCm38) M1183K probably benign Het
Olfr1444 T C 19: 12,862,713 (GRCm38) S313P possibly damaging Het
Olfr1468-ps1 T C 19: 13,375,040 (GRCm38) F26S probably damaging Het
Olfr676 T A 7: 105,035,907 (GRCm38) H236Q probably benign Het
Olfr889 T A 9: 38,115,892 (GRCm38) L37* probably null Het
Osbpl11 C G 16: 33,234,447 (GRCm38) N633K probably benign Het
Pcdhgb5 A G 18: 37,732,631 (GRCm38) E493G probably damaging Het
Phf20 T A 2: 156,294,138 (GRCm38) W626R probably damaging Het
Pkp2 C A 16: 16,240,659 (GRCm38) Q402K probably benign Het
Plch2 C T 4: 155,002,787 (GRCm38) D336N possibly damaging Het
Plk1 T C 7: 122,169,258 (GRCm38) F535L probably damaging Het
Ppp1r9a A T 6: 4,906,430 (GRCm38) E328D probably benign Het
Prss44 G A 9: 110,817,311 (GRCm38) V369M probably benign Het
Rilp A G 11: 75,510,972 (GRCm38) S193G probably benign Het
Rusc2 C T 4: 43,414,900 (GRCm38) Q69* probably null Het
Smc6 A G 12: 11,283,140 (GRCm38) R238G possibly damaging Het
Spen A G 4: 141,472,845 (GRCm38) S2824P probably damaging Het
Stk4 T C 2: 164,083,743 (GRCm38) M77T probably damaging Het
Syne2 A T 12: 75,949,064 (GRCm38) H2126L probably damaging Het
Thsd1 C T 8: 22,258,987 (GRCm38) R625* probably null Het
Tle3 A T 9: 61,412,856 (GRCm38) N522I probably damaging Het
Tmcc1 C A 6: 116,043,802 (GRCm38) E230* probably null Het
Vmn2r90 T C 17: 17,733,334 (GRCm38) S587P probably benign Het
Wt1 A T 2: 105,126,816 (GRCm38) Q7L probably benign Het
Zfhx2 T C 14: 55,062,849 (GRCm38) I2482V probably benign Het
Zfpm2 A T 15: 41,096,091 (GRCm38) I189F probably benign Het
Other mutations in Ryr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Ryr2 APN 13 11,834,092 (GRCm38) splice site probably benign
IGL00757:Ryr2 APN 13 11,618,604 (GRCm38) splice site probably null
IGL00838:Ryr2 APN 13 11,568,503 (GRCm38) missense probably damaging 0.98
IGL00849:Ryr2 APN 13 11,585,478 (GRCm38) missense possibly damaging 0.91
IGL00987:Ryr2 APN 13 11,735,502 (GRCm38) missense probably damaging 0.99
IGL01096:Ryr2 APN 13 11,703,544 (GRCm38) missense probably damaging 1.00
IGL01313:Ryr2 APN 13 11,638,485 (GRCm38) critical splice acceptor site probably null
IGL01349:Ryr2 APN 13 11,587,239 (GRCm38) missense possibly damaging 0.93
IGL01391:Ryr2 APN 13 11,556,685 (GRCm38) missense possibly damaging 0.96
IGL01401:Ryr2 APN 13 11,591,352 (GRCm38) missense possibly damaging 0.80
IGL01412:Ryr2 APN 13 11,742,036 (GRCm38) missense probably benign 0.10
IGL01419:Ryr2 APN 13 11,799,837 (GRCm38) missense possibly damaging 0.51
IGL01432:Ryr2 APN 13 11,851,204 (GRCm38) missense possibly damaging 0.63
IGL01533:Ryr2 APN 13 11,721,790 (GRCm38) missense probably damaging 1.00
IGL01571:Ryr2 APN 13 11,721,761 (GRCm38) missense probably damaging 1.00
IGL01584:Ryr2 APN 13 11,601,758 (GRCm38) critical splice donor site probably null
IGL01611:Ryr2 APN 13 11,591,316 (GRCm38) missense possibly damaging 0.67
IGL01632:Ryr2 APN 13 11,594,968 (GRCm38) missense probably damaging 0.97
IGL01643:Ryr2 APN 13 11,692,677 (GRCm38) missense possibly damaging 0.94
IGL01647:Ryr2 APN 13 11,585,480 (GRCm38) missense probably damaging 1.00
IGL01730:Ryr2 APN 13 11,601,842 (GRCm38) missense possibly damaging 0.86
IGL01834:Ryr2 APN 13 11,595,425 (GRCm38) missense possibly damaging 0.71
IGL01921:Ryr2 APN 13 11,554,550 (GRCm38) missense possibly damaging 0.96
IGL01937:Ryr2 APN 13 11,790,363 (GRCm38) missense probably damaging 1.00
IGL01945:Ryr2 APN 13 11,790,363 (GRCm38) missense probably damaging 1.00
IGL02027:Ryr2 APN 13 11,597,112 (GRCm38) missense probably damaging 1.00
IGL02060:Ryr2 APN 13 11,747,564 (GRCm38) missense probably damaging 1.00
IGL02065:Ryr2 APN 13 11,572,257 (GRCm38) missense possibly damaging 0.92
IGL02084:Ryr2 APN 13 11,792,762 (GRCm38) nonsense probably null
IGL02086:Ryr2 APN 13 11,735,556 (GRCm38) missense probably damaging 1.00
IGL02095:Ryr2 APN 13 11,759,759 (GRCm38) missense probably damaging 0.98
IGL02100:Ryr2 APN 13 11,737,873 (GRCm38) missense possibly damaging 0.92
IGL02122:Ryr2 APN 13 11,741,869 (GRCm38) missense probably damaging 1.00
IGL02202:Ryr2 APN 13 11,730,388 (GRCm38) missense probably damaging 0.97
IGL02202:Ryr2 APN 13 11,747,658 (GRCm38) splice site probably benign
IGL02369:Ryr2 APN 13 11,619,496 (GRCm38) missense possibly damaging 0.68
IGL02383:Ryr2 APN 13 11,722,721 (GRCm38) splice site probably benign
IGL02400:Ryr2 APN 13 11,605,244 (GRCm38) splice site probably benign
IGL02423:Ryr2 APN 13 11,745,198 (GRCm38) missense probably damaging 1.00
IGL02425:Ryr2 APN 13 11,745,674 (GRCm38) missense probably damaging 0.99
IGL02458:Ryr2 APN 13 11,705,699 (GRCm38) missense probably benign 0.15
IGL02602:Ryr2 APN 13 11,554,511 (GRCm38) utr 3 prime probably benign
IGL02694:Ryr2 APN 13 11,605,189 (GRCm38) missense probably damaging 1.00
IGL02726:Ryr2 APN 13 11,738,320 (GRCm38) missense probably damaging 1.00
IGL02747:Ryr2 APN 13 11,655,677 (GRCm38) missense probably damaging 1.00
IGL02795:Ryr2 APN 13 11,595,190 (GRCm38) missense probably benign 0.21
IGL02876:Ryr2 APN 13 11,707,793 (GRCm38) missense probably benign 0.39
IGL02878:Ryr2 APN 13 11,918,319 (GRCm38) missense probably benign 0.10
IGL02887:Ryr2 APN 13 11,591,269 (GRCm38) missense probably damaging 0.97
IGL02926:Ryr2 APN 13 11,759,835 (GRCm38) missense probably damaging 0.99
IGL03030:Ryr2 APN 13 11,684,479 (GRCm38) missense probably damaging 0.99
IGL03064:Ryr2 APN 13 11,643,902 (GRCm38) critical splice acceptor site probably null
IGL03102:Ryr2 APN 13 11,635,582 (GRCm38) splice site probably benign
IGL03152:Ryr2 APN 13 11,853,150 (GRCm38) missense probably damaging 1.00
IGL03176:Ryr2 APN 13 11,742,023 (GRCm38) nonsense probably null
IGL03180:Ryr2 APN 13 11,568,563 (GRCm38) missense possibly damaging 0.95
IGL03213:Ryr2 APN 13 11,724,387 (GRCm38) splice site probably benign
IGL03390:Ryr2 APN 13 11,772,416 (GRCm38) missense probably benign
IGL03410:Ryr2 APN 13 11,588,147 (GRCm38) missense probably damaging 0.99
Arruda UTSW 13 11,643,895 (GRCm38) missense probably damaging 1.00
Arruda2 UTSW 13 11,879,496 (GRCm38) missense probably damaging 1.00
Arruda3 UTSW 13 11,555,448 (GRCm38) missense possibly damaging 0.91
barricuda UTSW 13 11,595,014 (GRCm38) missense probably benign 0.06
BB006:Ryr2 UTSW 13 11,690,295 (GRCm38) nonsense probably null
BB006:Ryr2 UTSW 13 11,594,794 (GRCm38) missense probably damaging 1.00
BB016:Ryr2 UTSW 13 11,690,295 (GRCm38) nonsense probably null
BB016:Ryr2 UTSW 13 11,594,794 (GRCm38) missense probably damaging 1.00
H8562:Ryr2 UTSW 13 11,717,141 (GRCm38) splice site probably benign
IGL02799:Ryr2 UTSW 13 11,665,962 (GRCm38) missense probably damaging 1.00
IGL02991:Ryr2 UTSW 13 11,761,306 (GRCm38) missense probably damaging 0.99
PIT4142001:Ryr2 UTSW 13 11,707,796 (GRCm38) missense probably damaging 0.97
PIT4260001:Ryr2 UTSW 13 11,594,755 (GRCm38) missense possibly damaging 0.93
PIT4458001:Ryr2 UTSW 13 11,555,448 (GRCm38) missense probably benign 0.29
R0003:Ryr2 UTSW 13 11,824,379 (GRCm38) missense probably damaging 1.00
R0004:Ryr2 UTSW 13 11,665,919 (GRCm38) missense probably benign
R0018:Ryr2 UTSW 13 11,595,223 (GRCm38) missense possibly damaging 0.94
R0048:Ryr2 UTSW 13 11,595,784 (GRCm38) missense probably damaging 1.00
R0048:Ryr2 UTSW 13 11,595,784 (GRCm38) missense probably damaging 1.00
R0056:Ryr2 UTSW 13 11,669,038 (GRCm38) missense probably damaging 0.97
R0062:Ryr2 UTSW 13 11,869,116 (GRCm38) critical splice donor site probably null
R0062:Ryr2 UTSW 13 11,869,116 (GRCm38) critical splice donor site probably null
R0080:Ryr2 UTSW 13 11,568,475 (GRCm38) missense probably damaging 0.98
R0116:Ryr2 UTSW 13 11,709,921 (GRCm38) missense probably damaging 1.00
R0148:Ryr2 UTSW 13 11,714,548 (GRCm38) missense probably damaging 1.00
R0206:Ryr2 UTSW 13 11,676,251 (GRCm38) splice site probably benign
R0226:Ryr2 UTSW 13 11,772,556 (GRCm38) missense probably damaging 1.00
R0285:Ryr2 UTSW 13 11,716,977 (GRCm38) missense probably damaging 1.00
R0365:Ryr2 UTSW 13 11,668,839 (GRCm38) missense possibly damaging 0.90
R0401:Ryr2 UTSW 13 11,705,684 (GRCm38) missense probably benign 0.45
R0415:Ryr2 UTSW 13 11,869,156 (GRCm38) missense probably damaging 0.97
R0418:Ryr2 UTSW 13 11,834,095 (GRCm38) splice site probably benign
R0558:Ryr2 UTSW 13 11,799,861 (GRCm38) missense probably damaging 1.00
R0558:Ryr2 UTSW 13 11,638,443 (GRCm38) missense probably damaging 1.00
R0574:Ryr2 UTSW 13 11,731,669 (GRCm38) missense probably benign 0.02
R0586:Ryr2 UTSW 13 11,635,559 (GRCm38) missense probably null
R0601:Ryr2 UTSW 13 11,705,633 (GRCm38) critical splice donor site probably null
R0610:Ryr2 UTSW 13 11,622,952 (GRCm38) missense probably damaging 1.00
R0648:Ryr2 UTSW 13 11,724,333 (GRCm38) missense possibly damaging 0.86
R0727:Ryr2 UTSW 13 11,566,885 (GRCm38) missense probably damaging 1.00
R0743:Ryr2 UTSW 13 11,554,529 (GRCm38) missense probably damaging 0.99
R0821:Ryr2 UTSW 13 11,738,126 (GRCm38) missense probably benign 0.35
R0884:Ryr2 UTSW 13 11,554,529 (GRCm38) missense probably damaging 0.99
R1104:Ryr2 UTSW 13 11,669,969 (GRCm38) missense probably damaging 0.99
R1114:Ryr2 UTSW 13 11,945,981 (GRCm38) missense probably damaging 0.98
R1167:Ryr2 UTSW 13 11,660,113 (GRCm38) missense possibly damaging 0.94
R1238:Ryr2 UTSW 13 11,759,703 (GRCm38) missense probably damaging 1.00
R1239:Ryr2 UTSW 13 11,883,043 (GRCm38) critical splice donor site probably null
R1296:Ryr2 UTSW 13 11,687,879 (GRCm38) splice site probably benign
R1400:Ryr2 UTSW 13 11,595,076 (GRCm38) missense probably benign 0.08
R1439:Ryr2 UTSW 13 11,714,503 (GRCm38) splice site probably benign
R1443:Ryr2 UTSW 13 11,779,266 (GRCm38) missense probably benign 0.19
R1446:Ryr2 UTSW 13 11,738,149 (GRCm38) missense probably benign 0.09
R1458:Ryr2 UTSW 13 11,727,022 (GRCm38) missense probably damaging 0.97
R1497:Ryr2 UTSW 13 11,601,841 (GRCm38) missense probably damaging 0.99
R1505:Ryr2 UTSW 13 11,554,592 (GRCm38) missense possibly damaging 0.84
R1548:Ryr2 UTSW 13 11,554,549 (GRCm38) nonsense probably null
R1551:Ryr2 UTSW 13 11,785,143 (GRCm38) critical splice acceptor site probably null
R1567:Ryr2 UTSW 13 11,759,677 (GRCm38) missense possibly damaging 0.87
R1581:Ryr2 UTSW 13 11,794,563 (GRCm38) missense probably benign 0.01
R1645:Ryr2 UTSW 13 11,718,482 (GRCm38) nonsense probably null
R1686:Ryr2 UTSW 13 11,603,779 (GRCm38) splice site probably benign
R1696:Ryr2 UTSW 13 11,731,657 (GRCm38) missense probably benign 0.02
R1708:Ryr2 UTSW 13 11,587,442 (GRCm38) splice site probably null
R1728:Ryr2 UTSW 13 11,587,422 (GRCm38) missense possibly damaging 0.94
R1745:Ryr2 UTSW 13 11,790,267 (GRCm38) missense probably damaging 1.00
R1771:Ryr2 UTSW 13 11,745,176 (GRCm38) critical splice donor site probably null
R1776:Ryr2 UTSW 13 11,745,176 (GRCm38) critical splice donor site probably null
R1783:Ryr2 UTSW 13 11,700,371 (GRCm38) nonsense probably null
R1801:Ryr2 UTSW 13 11,595,281 (GRCm38) missense probably benign 0.01
R1812:Ryr2 UTSW 13 11,560,586 (GRCm38) missense probably damaging 0.97
R1820:Ryr2 UTSW 13 11,587,316 (GRCm38) missense probably damaging 0.99
R1835:Ryr2 UTSW 13 11,769,878 (GRCm38) missense probably benign 0.06
R1868:Ryr2 UTSW 13 11,731,700 (GRCm38) missense probably benign 0.02
R1869:Ryr2 UTSW 13 11,662,075 (GRCm38) missense probably damaging 0.98
R1884:Ryr2 UTSW 13 11,738,356 (GRCm38) missense probably damaging 0.97
R1892:Ryr2 UTSW 13 11,658,958 (GRCm38) nonsense probably null
R1897:Ryr2 UTSW 13 11,750,932 (GRCm38) missense probably benign 0.09
R1899:Ryr2 UTSW 13 11,591,336 (GRCm38) missense probably benign
R1909:Ryr2 UTSW 13 11,700,349 (GRCm38) missense probably damaging 1.00
R1918:Ryr2 UTSW 13 11,556,698 (GRCm38) missense possibly damaging 0.91
R1937:Ryr2 UTSW 13 11,668,962 (GRCm38) missense probably damaging 1.00
R1943:Ryr2 UTSW 13 11,731,723 (GRCm38) missense probably benign 0.10
R1956:Ryr2 UTSW 13 11,681,080 (GRCm38) missense probably damaging 1.00
R1983:Ryr2 UTSW 13 11,585,402 (GRCm38) splice site probably null
R2018:Ryr2 UTSW 13 11,851,188 (GRCm38) missense possibly damaging 0.59
R2019:Ryr2 UTSW 13 11,851,188 (GRCm38) missense possibly damaging 0.59
R2060:Ryr2 UTSW 13 11,595,736 (GRCm38) missense probably damaging 1.00
R2061:Ryr2 UTSW 13 11,665,878 (GRCm38) splice site probably null
R2088:Ryr2 UTSW 13 11,662,229 (GRCm38) missense probably benign 0.04
R2089:Ryr2 UTSW 13 11,945,977 (GRCm38) missense probably benign 0.23
R2091:Ryr2 UTSW 13 11,945,977 (GRCm38) missense probably benign 0.23
R2091:Ryr2 UTSW 13 11,945,977 (GRCm38) missense probably benign 0.23
R2127:Ryr2 UTSW 13 11,712,195 (GRCm38) missense probably damaging 1.00
R2140:Ryr2 UTSW 13 11,560,607 (GRCm38) missense probably damaging 1.00
R2153:Ryr2 UTSW 13 11,577,873 (GRCm38) missense possibly damaging 0.86
R2179:Ryr2 UTSW 13 11,705,793 (GRCm38) nonsense probably null
R2207:Ryr2 UTSW 13 11,810,937 (GRCm38) missense probably damaging 1.00
R2237:Ryr2 UTSW 13 11,662,260 (GRCm38) missense probably benign 0.18
R2258:Ryr2 UTSW 13 11,738,216 (GRCm38) missense possibly damaging 0.94
R2312:Ryr2 UTSW 13 11,738,242 (GRCm38) missense probably damaging 1.00
R2421:Ryr2 UTSW 13 11,591,237 (GRCm38) missense probably damaging 0.98
R2438:Ryr2 UTSW 13 11,801,848 (GRCm38) missense probably damaging 1.00
R2483:Ryr2 UTSW 13 11,759,703 (GRCm38) missense probably damaging 1.00
R2860:Ryr2 UTSW 13 11,593,093 (GRCm38) missense probably damaging 0.98
R2861:Ryr2 UTSW 13 11,593,093 (GRCm38) missense probably damaging 0.98
R2867:Ryr2 UTSW 13 11,761,349 (GRCm38) missense probably damaging 1.00
R2867:Ryr2 UTSW 13 11,761,349 (GRCm38) missense probably damaging 1.00
R3618:Ryr2 UTSW 13 11,772,580 (GRCm38) critical splice acceptor site probably null
R3876:Ryr2 UTSW 13 11,588,159 (GRCm38) missense probably damaging 0.99
R3906:Ryr2 UTSW 13 11,738,209 (GRCm38) missense possibly damaging 0.87
R3912:Ryr2 UTSW 13 11,772,427 (GRCm38) missense probably damaging 0.99
R4018:Ryr2 UTSW 13 11,918,414 (GRCm38) missense probably damaging 1.00
R4114:Ryr2 UTSW 13 11,692,682 (GRCm38) missense probably damaging 1.00
R4119:Ryr2 UTSW 13 11,779,267 (GRCm38) missense probably benign 0.22
R4127:Ryr2 UTSW 13 11,587,437 (GRCm38) missense possibly damaging 0.91
R4222:Ryr2 UTSW 13 11,737,873 (GRCm38) missense possibly damaging 0.92
R4233:Ryr2 UTSW 13 11,750,725 (GRCm38) missense probably benign 0.20
R4355:Ryr2 UTSW 13 11,649,812 (GRCm38) missense probably benign 0.05
R4384:Ryr2 UTSW 13 11,605,233 (GRCm38) missense probably damaging 0.99
R4422:Ryr2 UTSW 13 11,717,066 (GRCm38) nonsense probably null
R4430:Ryr2 UTSW 13 11,735,527 (GRCm38) missense probably damaging 0.98
R4624:Ryr2 UTSW 13 12,106,415 (GRCm38) missense possibly damaging 0.47
R4663:Ryr2 UTSW 13 11,749,509 (GRCm38) missense possibly damaging 0.47
R4665:Ryr2 UTSW 13 11,750,685 (GRCm38) splice site probably null
R4668:Ryr2 UTSW 13 11,593,117 (GRCm38) missense probably benign
R4677:Ryr2 UTSW 13 11,706,667 (GRCm38) missense probably damaging 0.98
R4679:Ryr2 UTSW 13 11,824,369 (GRCm38) missense probably benign 0.34
R4680:Ryr2 UTSW 13 11,595,233 (GRCm38) missense probably benign 0.04
R4685:Ryr2 UTSW 13 11,692,646 (GRCm38) missense probably damaging 1.00
R4709:Ryr2 UTSW 13 11,716,998 (GRCm38) missense probably damaging 1.00
R4731:Ryr2 UTSW 13 11,577,909 (GRCm38) missense possibly damaging 0.53
R4732:Ryr2 UTSW 13 11,577,909 (GRCm38) missense possibly damaging 0.53
R4733:Ryr2 UTSW 13 11,577,909 (GRCm38) missense possibly damaging 0.53
R4734:Ryr2 UTSW 13 11,737,753 (GRCm38) missense probably damaging 0.99
R4740:Ryr2 UTSW 13 11,657,047 (GRCm38) missense possibly damaging 0.95
R4801:Ryr2 UTSW 13 11,708,227 (GRCm38) missense probably damaging 1.00
R4801:Ryr2 UTSW 13 11,687,932 (GRCm38) missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11,687,932 (GRCm38) missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11,708,227 (GRCm38) missense probably damaging 1.00
R4804:Ryr2 UTSW 13 11,717,097 (GRCm38) missense probably damaging 1.00
R4811:Ryr2 UTSW 13 11,655,698 (GRCm38) missense probably damaging 0.97
R4850:Ryr2 UTSW 13 11,745,752 (GRCm38) missense probably damaging 1.00
R4850:Ryr2 UTSW 13 11,668,820 (GRCm38) missense probably damaging 0.99
R4880:Ryr2 UTSW 13 11,752,218 (GRCm38) missense probably damaging 1.00
R4917:Ryr2 UTSW 13 11,594,986 (GRCm38) missense probably damaging 0.96
R4918:Ryr2 UTSW 13 11,594,986 (GRCm38) missense probably damaging 0.96
R4922:Ryr2 UTSW 13 11,709,963 (GRCm38) missense probably damaging 0.99
R4933:Ryr2 UTSW 13 11,945,945 (GRCm38) missense probably damaging 0.96
R4950:Ryr2 UTSW 13 11,742,011 (GRCm38) missense probably damaging 1.00
R4957:Ryr2 UTSW 13 11,785,080 (GRCm38) missense probably damaging 0.97
R4964:Ryr2 UTSW 13 11,833,992 (GRCm38) missense probably benign 0.00
R4964:Ryr2 UTSW 13 11,714,611 (GRCm38) missense possibly damaging 0.49
R4966:Ryr2 UTSW 13 11,714,611 (GRCm38) missense possibly damaging 0.49
R4966:Ryr2 UTSW 13 11,833,992 (GRCm38) missense probably benign 0.00
R4997:Ryr2 UTSW 13 11,595,306 (GRCm38) missense probably benign 0.09
R4998:Ryr2 UTSW 13 11,643,895 (GRCm38) missense probably damaging 1.00
R5033:Ryr2 UTSW 13 11,587,254 (GRCm38) missense possibly damaging 0.93
R5061:Ryr2 UTSW 13 11,635,536 (GRCm38) missense possibly damaging 0.74
R5062:Ryr2 UTSW 13 11,700,354 (GRCm38) missense probably damaging 0.97
R5088:Ryr2 UTSW 13 11,712,243 (GRCm38) nonsense probably null
R5135:Ryr2 UTSW 13 11,662,130 (GRCm38) missense probably benign 0.05
R5138:Ryr2 UTSW 13 11,660,289 (GRCm38) missense probably damaging 1.00
R5168:Ryr2 UTSW 13 11,752,321 (GRCm38) missense probably benign
R5187:Ryr2 UTSW 13 11,772,452 (GRCm38) missense probably damaging 0.99
R5197:Ryr2 UTSW 13 11,638,430 (GRCm38) critical splice donor site probably null
R5262:Ryr2 UTSW 13 11,772,437 (GRCm38) missense probably damaging 0.99
R5325:Ryr2 UTSW 13 11,690,363 (GRCm38) missense probably damaging 0.97
R5381:Ryr2 UTSW 13 11,556,658 (GRCm38) missense probably damaging 1.00
R5437:Ryr2 UTSW 13 11,655,713 (GRCm38) missense probably damaging 1.00
R5477:Ryr2 UTSW 13 11,705,656 (GRCm38) missense probably damaging 1.00
R5497:Ryr2 UTSW 13 11,705,701 (GRCm38) missense probably null 0.15
R5509:Ryr2 UTSW 13 11,745,601 (GRCm38) missense probably damaging 0.98
R5518:Ryr2 UTSW 13 11,687,909 (GRCm38) missense probably benign 0.01
R5571:Ryr2 UTSW 13 11,555,448 (GRCm38) missense possibly damaging 0.91
R5591:Ryr2 UTSW 13 11,595,014 (GRCm38) missense probably benign 0.06
R5619:Ryr2 UTSW 13 11,708,202 (GRCm38) missense probably damaging 1.00
R5630:Ryr2 UTSW 13 11,601,805 (GRCm38) missense probably damaging 1.00
R5644:Ryr2 UTSW 13 11,595,582 (GRCm38) missense probably damaging 0.99
R5667:Ryr2 UTSW 13 11,759,836 (GRCm38) missense probably damaging 1.00
R5775:Ryr2 UTSW 13 11,769,962 (GRCm38) missense probably damaging 1.00
R5836:Ryr2 UTSW 13 11,603,732 (GRCm38) missense probably damaging 1.00
R5858:Ryr2 UTSW 13 11,560,574 (GRCm38) missense probably damaging 0.99
R5934:Ryr2 UTSW 13 11,584,154 (GRCm38) missense probably damaging 0.96
R5939:Ryr2 UTSW 13 11,790,332 (GRCm38) missense probably damaging 0.99
R5941:Ryr2 UTSW 13 11,687,902 (GRCm38) missense probably damaging 1.00
R5945:Ryr2 UTSW 13 11,660,122 (GRCm38) missense probably damaging 1.00
R5946:Ryr2 UTSW 13 11,726,953 (GRCm38) missense probably damaging 1.00
R5966:Ryr2 UTSW 13 11,662,238 (GRCm38) nonsense probably null
R5974:Ryr2 UTSW 13 11,714,511 (GRCm38) splice site probably null
R6104:Ryr2 UTSW 13 11,799,825 (GRCm38) missense probably damaging 1.00
R6118:Ryr2 UTSW 13 11,792,689 (GRCm38) missense possibly damaging 0.69
R6149:Ryr2 UTSW 13 11,669,017 (GRCm38) missense probably benign
R6208:Ryr2 UTSW 13 11,895,220 (GRCm38) missense probably benign 0.04
R6217:Ryr2 UTSW 13 11,834,078 (GRCm38) missense probably damaging 1.00
R6230:Ryr2 UTSW 13 11,660,107 (GRCm38) missense probably damaging 0.99
R6279:Ryr2 UTSW 13 11,680,999 (GRCm38) missense probably damaging 0.97
R6294:Ryr2 UTSW 13 11,879,496 (GRCm38) missense probably damaging 1.00
R6300:Ryr2 UTSW 13 11,680,999 (GRCm38) missense probably damaging 0.97
R6350:Ryr2 UTSW 13 11,761,396 (GRCm38) missense probably damaging 0.98
R6484:Ryr2 UTSW 13 11,662,383 (GRCm38) missense possibly damaging 0.90
R6489:Ryr2 UTSW 13 11,834,007 (GRCm38) missense probably benign 0.29
R6548:Ryr2 UTSW 13 11,668,821 (GRCm38) missense probably damaging 1.00
R6591:Ryr2 UTSW 13 11,594,723 (GRCm38) missense probably benign 0.01
R6623:Ryr2 UTSW 13 11,710,065 (GRCm38) missense probably damaging 1.00
R6649:Ryr2 UTSW 13 11,595,643 (GRCm38) missense probably damaging 0.99
R6691:Ryr2 UTSW 13 11,594,723 (GRCm38) missense probably benign 0.01
R6770:Ryr2 UTSW 13 11,738,462 (GRCm38) missense probably damaging 1.00
R6802:Ryr2 UTSW 13 11,686,966 (GRCm38) missense probably damaging 1.00
R6809:Ryr2 UTSW 13 11,726,930 (GRCm38) missense probably damaging 1.00
R6893:Ryr2 UTSW 13 11,829,654 (GRCm38) missense possibly damaging 0.75
R6911:Ryr2 UTSW 13 11,827,559 (GRCm38) missense possibly damaging 0.50
R6915:Ryr2 UTSW 13 11,745,601 (GRCm38) missense probably damaging 1.00
R6943:Ryr2 UTSW 13 11,566,948 (GRCm38) missense possibly damaging 0.92
R6960:Ryr2 UTSW 13 11,801,243 (GRCm38) missense probably benign 0.28
R6997:Ryr2 UTSW 13 11,654,380 (GRCm38) missense possibly damaging 0.88
R6998:Ryr2 UTSW 13 11,712,166 (GRCm38) missense probably damaging 0.99
R7001:Ryr2 UTSW 13 11,794,605 (GRCm38) missense probably damaging 0.98
R7047:Ryr2 UTSW 13 11,824,400 (GRCm38) missense possibly damaging 0.64
R7089:Ryr2 UTSW 13 11,649,776 (GRCm38) missense probably benign 0.10
R7125:Ryr2 UTSW 13 11,669,987 (GRCm38) missense probably damaging 0.99
R7127:Ryr2 UTSW 13 11,655,713 (GRCm38) missense probably damaging 1.00
R7131:Ryr2 UTSW 13 11,668,811 (GRCm38) critical splice donor site probably null
R7131:Ryr2 UTSW 13 11,640,327 (GRCm38) missense possibly damaging 0.63
R7159:Ryr2 UTSW 13 11,810,908 (GRCm38) missense probably damaging 0.99
R7174:Ryr2 UTSW 13 11,801,177 (GRCm38) missense possibly damaging 0.81
R7180:Ryr2 UTSW 13 11,686,978 (GRCm38) missense probably damaging 1.00
R7182:Ryr2 UTSW 13 11,759,757 (GRCm38) missense probably benign
R7189:Ryr2 UTSW 13 11,883,123 (GRCm38) missense probably damaging 1.00
R7241:Ryr2 UTSW 13 11,665,913 (GRCm38) missense possibly damaging 0.71
R7244:Ryr2 UTSW 13 11,597,146 (GRCm38) missense probably damaging 1.00
R7326:Ryr2 UTSW 13 11,738,194 (GRCm38) missense possibly damaging 0.95
R7331:Ryr2 UTSW 13 11,745,631 (GRCm38) missense probably benign
R7365:Ryr2 UTSW 13 11,640,275 (GRCm38) missense probably damaging 0.99
R7372:Ryr2 UTSW 13 11,680,999 (GRCm38) missense probably damaging 0.97
R7395:Ryr2 UTSW 13 11,785,111 (GRCm38) missense probably damaging 0.98
R7404:Ryr2 UTSW 13 11,735,620 (GRCm38) missense probably damaging 0.97
R7417:Ryr2 UTSW 13 11,556,748 (GRCm38) splice site probably null
R7425:Ryr2 UTSW 13 11,705,644 (GRCm38) missense probably benign 0.20
R7444:Ryr2 UTSW 13 11,555,463 (GRCm38) missense probably benign 0.25
R7456:Ryr2 UTSW 13 11,752,282 (GRCm38) missense probably benign
R7460:Ryr2 UTSW 13 11,705,710 (GRCm38) missense probably benign 0.10
R7474:Ryr2 UTSW 13 11,594,876 (GRCm38) missense probably benign 0.04
R7543:Ryr2 UTSW 13 11,638,431 (GRCm38) critical splice donor site probably null
R7549:Ryr2 UTSW 13 11,737,985 (GRCm38) missense probably benign 0.15
R7558:Ryr2 UTSW 13 11,799,825 (GRCm38) missense probably damaging 1.00
R7565:Ryr2 UTSW 13 11,560,653 (GRCm38) missense possibly damaging 0.84
R7627:Ryr2 UTSW 13 11,761,327 (GRCm38) missense possibly damaging 0.65
R7702:Ryr2 UTSW 13 11,690,333 (GRCm38) missense probably damaging 0.99
R7719:Ryr2 UTSW 13 11,730,343 (GRCm38) missense possibly damaging 0.94
R7772:Ryr2 UTSW 13 11,751,011 (GRCm38) missense probably benign
R7797:Ryr2 UTSW 13 11,801,180 (GRCm38) missense probably damaging 0.99
R7829:Ryr2 UTSW 13 11,827,607 (GRCm38) missense possibly damaging 0.81
R7855:Ryr2 UTSW 13 11,706,623 (GRCm38) nonsense probably null
R7872:Ryr2 UTSW 13 11,595,724 (GRCm38) missense probably damaging 1.00
R7908:Ryr2 UTSW 13 11,792,748 (GRCm38) missense probably benign 0.01
R7929:Ryr2 UTSW 13 11,594,794 (GRCm38) missense probably damaging 1.00
R7929:Ryr2 UTSW 13 11,690,295 (GRCm38) nonsense probably null
R7952:Ryr2 UTSW 13 11,646,427 (GRCm38) splice site probably null
R8008:Ryr2 UTSW 13 11,657,094 (GRCm38) missense probably benign 0.30
R8011:Ryr2 UTSW 13 11,588,140 (GRCm38) critical splice donor site probably null
R8097:Ryr2 UTSW 13 11,945,995 (GRCm38) missense probably damaging 0.98
R8133:Ryr2 UTSW 13 11,603,698 (GRCm38) missense probably damaging 1.00
R8253:Ryr2 UTSW 13 11,827,553 (GRCm38) missense possibly damaging 0.94
R8278:Ryr2 UTSW 13 11,595,506 (GRCm38) nonsense probably null
R8351:Ryr2 UTSW 13 11,799,832 (GRCm38) missense probably damaging 0.98
R8401:Ryr2 UTSW 13 11,668,935 (GRCm38) missense possibly damaging 0.95
R8403:Ryr2 UTSW 13 11,684,478 (GRCm38) missense possibly damaging 0.95
R8431:Ryr2 UTSW 13 11,659,008 (GRCm38) missense probably benign 0.00
R8509:Ryr2 UTSW 13 11,577,778 (GRCm38) critical splice donor site probably null
R8551:Ryr2 UTSW 13 11,560,593 (GRCm38) missense possibly damaging 0.93
R8684:Ryr2 UTSW 13 11,687,989 (GRCm38) missense probably damaging 0.99
R8735:Ryr2 UTSW 13 11,686,947 (GRCm38) missense probably damaging 0.97
R8766:Ryr2 UTSW 13 11,668,969 (GRCm38) missense probably damaging 0.97
R8817:Ryr2 UTSW 13 11,735,623 (GRCm38) missense possibly damaging 0.95
R8827:Ryr2 UTSW 13 11,558,048 (GRCm38) missense possibly damaging 0.80
R8884:Ryr2 UTSW 13 11,779,266 (GRCm38) missense probably benign 0.19
R8889:Ryr2 UTSW 13 11,785,104 (GRCm38) missense probably damaging 0.99
R8891:Ryr2 UTSW 13 11,799,882 (GRCm38) missense probably damaging 1.00
R8979:Ryr2 UTSW 13 11,595,038 (GRCm38) missense probably benign 0.00
R9013:Ryr2 UTSW 13 11,603,732 (GRCm38) missense probably damaging 0.98
R9040:Ryr2 UTSW 13 11,594,786 (GRCm38) missense probably damaging 0.97
R9044:Ryr2 UTSW 13 11,738,103 (GRCm38) nonsense probably null
R9056:Ryr2 UTSW 13 11,595,931 (GRCm38) missense possibly damaging 0.94
R9084:Ryr2 UTSW 13 11,601,838 (GRCm38) missense probably damaging 1.00
R9113:Ryr2 UTSW 13 11,603,855 (GRCm38) intron probably benign
R9116:Ryr2 UTSW 13 11,572,299 (GRCm38) missense possibly damaging 0.93
R9125:Ryr2 UTSW 13 11,654,406 (GRCm38) missense probably benign 0.28
R9148:Ryr2 UTSW 13 11,885,538 (GRCm38) missense probably benign 0.02
R9210:Ryr2 UTSW 13 11,829,674 (GRCm38) missense probably damaging 0.99
R9212:Ryr2 UTSW 13 11,829,674 (GRCm38) missense probably damaging 0.99
R9233:Ryr2 UTSW 13 11,595,886 (GRCm38) missense possibly damaging 0.77
R9254:Ryr2 UTSW 13 11,883,116 (GRCm38) missense probably damaging 1.00
R9262:Ryr2 UTSW 13 11,750,968 (GRCm38) missense probably damaging 0.97
R9275:Ryr2 UTSW 13 11,883,090 (GRCm38) missense probably benign 0.10
R9278:Ryr2 UTSW 13 11,883,090 (GRCm38) missense probably benign 0.10
R9309:Ryr2 UTSW 13 11,706,692 (GRCm38) missense probably damaging 0.99
R9379:Ryr2 UTSW 13 11,883,116 (GRCm38) missense probably damaging 1.00
R9409:Ryr2 UTSW 13 11,681,087 (GRCm38) missense probably damaging 0.99
R9429:Ryr2 UTSW 13 11,794,573 (GRCm38) missense probably damaging 0.97
R9445:Ryr2 UTSW 13 11,772,577 (GRCm38) missense probably damaging 1.00
R9464:Ryr2 UTSW 13 11,737,794 (GRCm38) missense probably benign 0.00
R9467:Ryr2 UTSW 13 11,556,604 (GRCm38) missense possibly damaging 0.70
R9546:Ryr2 UTSW 13 11,587,215 (GRCm38) critical splice donor site probably null
R9562:Ryr2 UTSW 13 11,745,218 (GRCm38) missense probably damaging 1.00
R9609:Ryr2 UTSW 13 11,668,962 (GRCm38) missense probably damaging 1.00
R9704:Ryr2 UTSW 13 11,722,760 (GRCm38) missense probably damaging 1.00
R9764:Ryr2 UTSW 13 11,687,049 (GRCm38) missense possibly damaging 0.67
R9772:Ryr2 UTSW 13 11,594,899 (GRCm38) missense probably benign 0.13
R9776:Ryr2 UTSW 13 11,692,713 (GRCm38) missense probably damaging 0.98
S24628:Ryr2 UTSW 13 11,869,156 (GRCm38) missense probably damaging 0.97
X0019:Ryr2 UTSW 13 11,703,501 (GRCm38) missense probably benign 0.04
Z1176:Ryr2 UTSW 13 11,643,803 (GRCm38) critical splice donor site probably null
Z1176:Ryr2 UTSW 13 11,598,611 (GRCm38) critical splice acceptor site probably null
Z1176:Ryr2 UTSW 13 11,794,549 (GRCm38) nonsense probably null
Z1177:Ryr2 UTSW 13 11,750,873 (GRCm38) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ACTAAAGAGACATGTCCAAGGTC -3'
(R):5'- AGCCTTCCAGTGGGTTTTACG -3'

Sequencing Primer
(F):5'- AGACATGTCCAAGGTCTGCTG -3'
(R):5'- TTACGACTGAGTTAGGTCAAGCCC -3'
Posted On 2019-11-12