Incidental Mutation 'R9116:Ryr2'
ID 692560
Institutional Source Beutler Lab
Gene Symbol Ryr2
Ensembl Gene ENSMUSG00000021313
Gene Name ryanodine receptor 2, cardiac
Synonyms 9330127I20Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9116 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 11553102-12106945 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 11572299 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 4699 (S4699P)
Ref Sequence ENSEMBL: ENSMUSP00000021750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021750] [ENSMUST00000170156]
AlphaFold no structure available at present
PDB Structure X-ray crystallography-solution NMR hybrid structure of mouse RyR2 domain A [SOLUTION NMR]
Crystal structure of mouse Ryanodine Receptor 2 (residues 1-217) [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 mutant V186M [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 N-terminal domain (1-217) disease mutant A77V [X-RAY DIFFRACTION]
Structure of the first domain of a cardiac Ryanodine Receptor mutant with exon 3 deleted [X-RAY DIFFRACTION]
Crystal structure of mouse ryanodine receptor 2 (2699-2904) [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant P164S [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant R169Q [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant R176Q [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor isoform 2 (RyR2) 1-547 [X-RAY DIFFRACTION]
>> 3 additional structures at PDB <<
Predicted Effect possibly damaging
Transcript: ENSMUST00000021750
AA Change: S4699P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021750
Gene: ENSMUSG00000021313
AA Change: S4699P

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 454 648 3.1e-65 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 862 952 1.8e-36 PFAM
Pfam:RyR 976 1066 1.1e-32 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2122 2331 1.2e-71 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2700 2790 1.1e-33 PFAM
Pfam:RyR 2820 2904 7.1e-27 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3829 3947 3.1e-36 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.7e-96 PFAM
Pfam:Ion_trans 4710 4877 8e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170156
AA Change: S4699P

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127991
Gene: ENSMUSG00000021313
AA Change: S4699P

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 451 655 3.5e-73 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 861 955 1.4e-33 PFAM
Pfam:RyR 975 1069 9.2e-34 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2120 2331 3.9e-65 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2699 2793 1.1e-37 PFAM
Pfam:RyR 2819 2907 9.4e-34 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3825 3958 2.3e-42 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.1e-93 PFAM
Pfam:Ion_trans 4705 4865 9.3e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (76/76)
MGI Phenotype Strain: 3640298
Lethality: E9-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show embryonic lethality during organogenesis and altered cardiomyocyte morphology. Homozygotes for a phosphorylation defective allele show decreased susceptibility to myocardial infarction-induced heart failure. Homozygotes for the R420W allele show lymphoid organ hypertrophy. [provided by MGI curators]
Allele List at MGI

All alleles(44) : Targeted(17) Gene trapped(27)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,003,139 (GRCm38) L689Q Het
Abcc2 G A 19: 43,804,952 (GRCm38) V348M probably benign Het
Abhd5 T C 9: 122,367,927 (GRCm38) S60P probably benign Het
Adamts10 C A 17: 33,537,356 (GRCm38) H324Q probably benign Het
Akap1 A G 11: 88,832,339 (GRCm38) L823P probably damaging Het
Aoc1 G A 6: 48,908,588 (GRCm38) V676I probably damaging Het
Arhgef12 T C 9: 42,981,945 (GRCm38) probably benign Het
Arl4d A C 11: 101,666,794 (GRCm38) S49R possibly damaging Het
Atr A G 9: 95,865,798 (GRCm38) I378V probably benign Het
Bicd1 G A 6: 149,484,176 (GRCm38) V136I probably benign Het
Brd1 A T 15: 88,701,171 (GRCm38) L820H possibly damaging Het
Cfap70 T C 14: 20,447,522 (GRCm38) T55A probably benign Het
Cog7 G T 7: 121,971,338 (GRCm38) N182K probably damaging Het
Col4a4 T A 1: 82,454,031 (GRCm38) T1511S unknown Het
Cr2 A T 1: 195,158,669 (GRCm38) Y438* probably null Het
Ctnnbl1 T A 2: 157,806,703 (GRCm38) V198E probably damaging Het
Fam117b C T 1: 59,979,297 (GRCm38) Q58* probably null Het
Fam171a2 A G 11: 102,439,693 (GRCm38) Y288H probably damaging Het
Fam186a A T 15: 99,942,591 (GRCm38) I1924K possibly damaging Het
Fancd2 A G 6: 113,555,219 (GRCm38) I498V probably benign Het
Fat3 T A 9: 15,998,125 (GRCm38) I2194F probably benign Het
Flg2 T C 3: 93,202,284 (GRCm38) S540P unknown Het
Gbp9 T C 5: 105,083,829 (GRCm38) Y297C Het
Gck T G 11: 5,904,377 (GRCm38) N283H possibly damaging Het
Gm13941 A T 2: 111,104,801 (GRCm38) L28Q unknown Het
Gpr155 A G 2: 73,373,765 (GRCm38) I235T possibly damaging Het
Junb A C 8: 84,977,423 (GRCm38) L336R probably damaging Het
Krt14 A T 11: 100,205,078 (GRCm38) M218K probably benign Het
Leprotl1 A G 8: 34,137,813 (GRCm38) V102A probably benign Het
Lrrc8d T C 5: 105,814,042 (GRCm38) F773L probably damaging Het
Mad2l1bp G A 17: 46,148,032 (GRCm38) R191C probably damaging Het
Man1c1 C T 4: 134,584,394 (GRCm38) V274M possibly damaging Het
Mtor C A 4: 148,552,741 (GRCm38) P2466T probably benign Het
Mycbpap C A 11: 94,507,206 (GRCm38) probably benign Het
Myef2l G A 3: 10,088,533 (GRCm38) V121M probably damaging Het
Myo18b T C 5: 112,827,996 (GRCm38) E1329G probably damaging Het
Nipbl A T 15: 8,350,856 (GRCm38) D817E probably benign Het
Nthl1 C T 17: 24,634,779 (GRCm38) Q133* probably null Het
Nup133 A G 8: 123,933,416 (GRCm38) M381T probably benign Het
Or13c7 T C 4: 43,854,602 (GRCm38) C98R probably damaging Het
Or2j3 T C 17: 38,304,763 (GRCm38) T233A probably benign Het
Or51t4 T C 7: 102,949,320 (GRCm38) I285T possibly damaging Het
Or7e175 T C 9: 20,137,337 (GRCm38) Y74H probably damaging Het
Or7g20 T C 9: 19,035,477 (GRCm38) M118T probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm38) probably benign Het
Pmm1 C T 15: 81,955,695 (GRCm38) R143H probably damaging Het
Pmpcb A T 5: 21,756,610 (GRCm38) I422F probably damaging Het
Prpf8 T A 11: 75,489,763 (GRCm38) H97Q possibly damaging Het
Psat1 A G 19: 15,920,968 (GRCm38) L30P probably damaging Het
Rag1 C T 2: 101,644,792 (GRCm38) A2T probably benign Het
Rag1 T C 2: 101,642,475 (GRCm38) D774G probably damaging Het
Rccd1 G T 7: 80,320,980 (GRCm38) F17L probably damaging Het
Rhobtb1 T A 10: 69,270,749 (GRCm38) D443E probably damaging Het
Rnf13 A G 3: 57,802,445 (GRCm38) probably null Het
Scart1 A G 7: 140,228,364 (GRCm38) T754A probably benign Het
Sdc3 T C 4: 130,819,041 (GRCm38) V237A probably benign Het
Serinc5 T A 13: 92,661,006 (GRCm38) probably benign Het
Sertad4 A G 1: 192,846,665 (GRCm38) I281T probably benign Het
Shroom1 T C 11: 53,463,663 (GRCm38) S137P probably damaging Het
Slurp1 C T 15: 74,727,601 (GRCm38) G20D probably damaging Het
Sncb T A 13: 54,762,699 (GRCm38) N75Y probably damaging Het
Spag8 C T 4: 43,653,231 (GRCm38) G77S unknown Het
Spink14 A T 18: 44,030,992 (GRCm38) I76F probably damaging Het
Srfbp1 A T 18: 52,490,030 (GRCm38) E372D possibly damaging Het
Synpo A T 18: 60,602,527 (GRCm38) N782K probably damaging Het
Syt7 T C 19: 10,444,009 (GRCm38) M519T probably damaging Het
Tlr5 C T 1: 182,974,595 (GRCm38) P488L probably benign Het
Tmod3 A T 9: 75,504,920 (GRCm38) I315N probably damaging Het
Ttc12 T C 9: 49,453,457 (GRCm38) M340V probably benign Het
Ttn A G 2: 76,938,888 (GRCm38) V2822A unknown Het
Ttn T A 2: 76,880,615 (GRCm38) I8392F unknown Het
Ube3b C T 5: 114,404,776 (GRCm38) probably benign Het
Ubr4 C A 4: 139,418,474 (GRCm38) N238K Het
Vmn2r12 T C 5: 109,086,019 (GRCm38) T776A probably damaging Het
Vps50 G A 6: 3,588,091 (GRCm38) probably benign Het
Vwa3a A G 7: 120,767,247 (GRCm38) D165G Het
Wdr17 T A 8: 54,661,570 (GRCm38) H644L probably damaging Het
Zfp628 T C 7: 4,921,203 (GRCm38) V808A probably benign Het
Zscan21 T A 5: 138,125,675 (GRCm38) D205E probably damaging Het
Other mutations in Ryr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Ryr2 APN 13 11,834,092 (GRCm38) splice site probably benign
IGL00757:Ryr2 APN 13 11,618,604 (GRCm38) splice site probably null
IGL00838:Ryr2 APN 13 11,568,503 (GRCm38) missense probably damaging 0.98
IGL00849:Ryr2 APN 13 11,585,478 (GRCm38) missense possibly damaging 0.91
IGL00987:Ryr2 APN 13 11,735,502 (GRCm38) missense probably damaging 0.99
IGL01096:Ryr2 APN 13 11,703,544 (GRCm38) missense probably damaging 1.00
IGL01313:Ryr2 APN 13 11,638,485 (GRCm38) critical splice acceptor site probably null
IGL01349:Ryr2 APN 13 11,587,239 (GRCm38) missense possibly damaging 0.93
IGL01391:Ryr2 APN 13 11,556,685 (GRCm38) missense possibly damaging 0.96
IGL01401:Ryr2 APN 13 11,591,352 (GRCm38) missense possibly damaging 0.80
IGL01412:Ryr2 APN 13 11,742,036 (GRCm38) missense probably benign 0.10
IGL01419:Ryr2 APN 13 11,799,837 (GRCm38) missense possibly damaging 0.51
IGL01432:Ryr2 APN 13 11,851,204 (GRCm38) missense possibly damaging 0.63
IGL01533:Ryr2 APN 13 11,721,790 (GRCm38) missense probably damaging 1.00
IGL01571:Ryr2 APN 13 11,721,761 (GRCm38) missense probably damaging 1.00
IGL01584:Ryr2 APN 13 11,601,758 (GRCm38) critical splice donor site probably null
IGL01611:Ryr2 APN 13 11,591,316 (GRCm38) missense possibly damaging 0.67
IGL01632:Ryr2 APN 13 11,594,968 (GRCm38) missense probably damaging 0.97
IGL01643:Ryr2 APN 13 11,692,677 (GRCm38) missense possibly damaging 0.94
IGL01647:Ryr2 APN 13 11,585,480 (GRCm38) missense probably damaging 1.00
IGL01730:Ryr2 APN 13 11,601,842 (GRCm38) missense possibly damaging 0.86
IGL01834:Ryr2 APN 13 11,595,425 (GRCm38) missense possibly damaging 0.71
IGL01921:Ryr2 APN 13 11,554,550 (GRCm38) missense possibly damaging 0.96
IGL01937:Ryr2 APN 13 11,790,363 (GRCm38) missense probably damaging 1.00
IGL01945:Ryr2 APN 13 11,790,363 (GRCm38) missense probably damaging 1.00
IGL02027:Ryr2 APN 13 11,597,112 (GRCm38) missense probably damaging 1.00
IGL02060:Ryr2 APN 13 11,747,564 (GRCm38) missense probably damaging 1.00
IGL02065:Ryr2 APN 13 11,572,257 (GRCm38) missense possibly damaging 0.92
IGL02084:Ryr2 APN 13 11,792,762 (GRCm38) nonsense probably null
IGL02086:Ryr2 APN 13 11,735,556 (GRCm38) missense probably damaging 1.00
IGL02095:Ryr2 APN 13 11,759,759 (GRCm38) missense probably damaging 0.98
IGL02100:Ryr2 APN 13 11,737,873 (GRCm38) missense possibly damaging 0.92
IGL02122:Ryr2 APN 13 11,741,869 (GRCm38) missense probably damaging 1.00
IGL02202:Ryr2 APN 13 11,730,388 (GRCm38) missense probably damaging 0.97
IGL02202:Ryr2 APN 13 11,747,658 (GRCm38) splice site probably benign
IGL02369:Ryr2 APN 13 11,619,496 (GRCm38) missense possibly damaging 0.68
IGL02383:Ryr2 APN 13 11,722,721 (GRCm38) splice site probably benign
IGL02400:Ryr2 APN 13 11,605,244 (GRCm38) splice site probably benign
IGL02423:Ryr2 APN 13 11,745,198 (GRCm38) missense probably damaging 1.00
IGL02425:Ryr2 APN 13 11,745,674 (GRCm38) missense probably damaging 0.99
IGL02458:Ryr2 APN 13 11,705,699 (GRCm38) missense probably benign 0.15
IGL02602:Ryr2 APN 13 11,554,511 (GRCm38) utr 3 prime probably benign
IGL02694:Ryr2 APN 13 11,605,189 (GRCm38) missense probably damaging 1.00
IGL02726:Ryr2 APN 13 11,738,320 (GRCm38) missense probably damaging 1.00
IGL02747:Ryr2 APN 13 11,655,677 (GRCm38) missense probably damaging 1.00
IGL02795:Ryr2 APN 13 11,595,190 (GRCm38) missense probably benign 0.21
IGL02876:Ryr2 APN 13 11,707,793 (GRCm38) missense probably benign 0.39
IGL02878:Ryr2 APN 13 11,918,319 (GRCm38) missense probably benign 0.10
IGL02887:Ryr2 APN 13 11,591,269 (GRCm38) missense probably damaging 0.97
IGL02926:Ryr2 APN 13 11,759,835 (GRCm38) missense probably damaging 0.99
IGL03030:Ryr2 APN 13 11,684,479 (GRCm38) missense probably damaging 0.99
IGL03064:Ryr2 APN 13 11,643,902 (GRCm38) critical splice acceptor site probably null
IGL03102:Ryr2 APN 13 11,635,582 (GRCm38) splice site probably benign
IGL03152:Ryr2 APN 13 11,853,150 (GRCm38) missense probably damaging 1.00
IGL03176:Ryr2 APN 13 11,742,023 (GRCm38) nonsense probably null
IGL03180:Ryr2 APN 13 11,568,563 (GRCm38) missense possibly damaging 0.95
IGL03213:Ryr2 APN 13 11,724,387 (GRCm38) splice site probably benign
IGL03390:Ryr2 APN 13 11,772,416 (GRCm38) missense probably benign
IGL03410:Ryr2 APN 13 11,588,147 (GRCm38) missense probably damaging 0.99
Arruda UTSW 13 11,643,895 (GRCm38) missense probably damaging 1.00
Arruda2 UTSW 13 11,879,496 (GRCm38) missense probably damaging 1.00
Arruda3 UTSW 13 11,555,448 (GRCm38) missense possibly damaging 0.91
barricuda UTSW 13 11,595,014 (GRCm38) missense probably benign 0.06
BB006:Ryr2 UTSW 13 11,690,295 (GRCm38) nonsense probably null
BB006:Ryr2 UTSW 13 11,594,794 (GRCm38) missense probably damaging 1.00
BB016:Ryr2 UTSW 13 11,690,295 (GRCm38) nonsense probably null
BB016:Ryr2 UTSW 13 11,594,794 (GRCm38) missense probably damaging 1.00
H8562:Ryr2 UTSW 13 11,717,141 (GRCm38) splice site probably benign
IGL02799:Ryr2 UTSW 13 11,665,962 (GRCm38) missense probably damaging 1.00
IGL02991:Ryr2 UTSW 13 11,761,306 (GRCm38) missense probably damaging 0.99
PIT4142001:Ryr2 UTSW 13 11,707,796 (GRCm38) missense probably damaging 0.97
PIT4260001:Ryr2 UTSW 13 11,594,755 (GRCm38) missense possibly damaging 0.93
PIT4458001:Ryr2 UTSW 13 11,555,448 (GRCm38) missense probably benign 0.29
R0003:Ryr2 UTSW 13 11,824,379 (GRCm38) missense probably damaging 1.00
R0004:Ryr2 UTSW 13 11,665,919 (GRCm38) missense probably benign
R0018:Ryr2 UTSW 13 11,595,223 (GRCm38) missense possibly damaging 0.94
R0048:Ryr2 UTSW 13 11,595,784 (GRCm38) missense probably damaging 1.00
R0048:Ryr2 UTSW 13 11,595,784 (GRCm38) missense probably damaging 1.00
R0056:Ryr2 UTSW 13 11,669,038 (GRCm38) missense probably damaging 0.97
R0062:Ryr2 UTSW 13 11,869,116 (GRCm38) critical splice donor site probably null
R0062:Ryr2 UTSW 13 11,869,116 (GRCm38) critical splice donor site probably null
R0080:Ryr2 UTSW 13 11,568,475 (GRCm38) missense probably damaging 0.98
R0116:Ryr2 UTSW 13 11,709,921 (GRCm38) missense probably damaging 1.00
R0148:Ryr2 UTSW 13 11,714,548 (GRCm38) missense probably damaging 1.00
R0206:Ryr2 UTSW 13 11,676,251 (GRCm38) splice site probably benign
R0226:Ryr2 UTSW 13 11,772,556 (GRCm38) missense probably damaging 1.00
R0285:Ryr2 UTSW 13 11,716,977 (GRCm38) missense probably damaging 1.00
R0365:Ryr2 UTSW 13 11,668,839 (GRCm38) missense possibly damaging 0.90
R0401:Ryr2 UTSW 13 11,705,684 (GRCm38) missense probably benign 0.45
R0415:Ryr2 UTSW 13 11,869,156 (GRCm38) missense probably damaging 0.97
R0418:Ryr2 UTSW 13 11,834,095 (GRCm38) splice site probably benign
R0558:Ryr2 UTSW 13 11,799,861 (GRCm38) missense probably damaging 1.00
R0558:Ryr2 UTSW 13 11,638,443 (GRCm38) missense probably damaging 1.00
R0574:Ryr2 UTSW 13 11,731,669 (GRCm38) missense probably benign 0.02
R0586:Ryr2 UTSW 13 11,635,559 (GRCm38) missense probably null
R0601:Ryr2 UTSW 13 11,705,633 (GRCm38) critical splice donor site probably null
R0610:Ryr2 UTSW 13 11,622,952 (GRCm38) missense probably damaging 1.00
R0648:Ryr2 UTSW 13 11,724,333 (GRCm38) missense possibly damaging 0.86
R0727:Ryr2 UTSW 13 11,566,885 (GRCm38) missense probably damaging 1.00
R0743:Ryr2 UTSW 13 11,554,529 (GRCm38) missense probably damaging 0.99
R0821:Ryr2 UTSW 13 11,738,126 (GRCm38) missense probably benign 0.35
R0884:Ryr2 UTSW 13 11,554,529 (GRCm38) missense probably damaging 0.99
R1104:Ryr2 UTSW 13 11,669,969 (GRCm38) missense probably damaging 0.99
R1114:Ryr2 UTSW 13 11,945,981 (GRCm38) missense probably damaging 0.98
R1167:Ryr2 UTSW 13 11,660,113 (GRCm38) missense possibly damaging 0.94
R1238:Ryr2 UTSW 13 11,759,703 (GRCm38) missense probably damaging 1.00
R1239:Ryr2 UTSW 13 11,883,043 (GRCm38) critical splice donor site probably null
R1296:Ryr2 UTSW 13 11,687,879 (GRCm38) splice site probably benign
R1400:Ryr2 UTSW 13 11,595,076 (GRCm38) missense probably benign 0.08
R1439:Ryr2 UTSW 13 11,714,503 (GRCm38) splice site probably benign
R1443:Ryr2 UTSW 13 11,779,266 (GRCm38) missense probably benign 0.19
R1446:Ryr2 UTSW 13 11,738,149 (GRCm38) missense probably benign 0.09
R1458:Ryr2 UTSW 13 11,727,022 (GRCm38) missense probably damaging 0.97
R1497:Ryr2 UTSW 13 11,601,841 (GRCm38) missense probably damaging 0.99
R1505:Ryr2 UTSW 13 11,554,592 (GRCm38) missense possibly damaging 0.84
R1548:Ryr2 UTSW 13 11,554,549 (GRCm38) nonsense probably null
R1551:Ryr2 UTSW 13 11,785,143 (GRCm38) critical splice acceptor site probably null
R1567:Ryr2 UTSW 13 11,759,677 (GRCm38) missense possibly damaging 0.87
R1581:Ryr2 UTSW 13 11,794,563 (GRCm38) missense probably benign 0.01
R1645:Ryr2 UTSW 13 11,718,482 (GRCm38) nonsense probably null
R1686:Ryr2 UTSW 13 11,603,779 (GRCm38) splice site probably benign
R1696:Ryr2 UTSW 13 11,731,657 (GRCm38) missense probably benign 0.02
R1708:Ryr2 UTSW 13 11,587,442 (GRCm38) splice site probably null
R1728:Ryr2 UTSW 13 11,587,422 (GRCm38) missense possibly damaging 0.94
R1745:Ryr2 UTSW 13 11,790,267 (GRCm38) missense probably damaging 1.00
R1771:Ryr2 UTSW 13 11,745,176 (GRCm38) critical splice donor site probably null
R1776:Ryr2 UTSW 13 11,745,176 (GRCm38) critical splice donor site probably null
R1783:Ryr2 UTSW 13 11,700,371 (GRCm38) nonsense probably null
R1801:Ryr2 UTSW 13 11,595,281 (GRCm38) missense probably benign 0.01
R1812:Ryr2 UTSW 13 11,560,586 (GRCm38) missense probably damaging 0.97
R1820:Ryr2 UTSW 13 11,587,316 (GRCm38) missense probably damaging 0.99
R1835:Ryr2 UTSW 13 11,769,878 (GRCm38) missense probably benign 0.06
R1868:Ryr2 UTSW 13 11,731,700 (GRCm38) missense probably benign 0.02
R1869:Ryr2 UTSW 13 11,662,075 (GRCm38) missense probably damaging 0.98
R1884:Ryr2 UTSW 13 11,738,356 (GRCm38) missense probably damaging 0.97
R1892:Ryr2 UTSW 13 11,658,958 (GRCm38) nonsense probably null
R1897:Ryr2 UTSW 13 11,750,932 (GRCm38) missense probably benign 0.09
R1899:Ryr2 UTSW 13 11,591,336 (GRCm38) missense probably benign
R1909:Ryr2 UTSW 13 11,700,349 (GRCm38) missense probably damaging 1.00
R1918:Ryr2 UTSW 13 11,556,698 (GRCm38) missense possibly damaging 0.91
R1937:Ryr2 UTSW 13 11,668,962 (GRCm38) missense probably damaging 1.00
R1943:Ryr2 UTSW 13 11,731,723 (GRCm38) missense probably benign 0.10
R1956:Ryr2 UTSW 13 11,681,080 (GRCm38) missense probably damaging 1.00
R1983:Ryr2 UTSW 13 11,585,402 (GRCm38) splice site probably null
R2018:Ryr2 UTSW 13 11,851,188 (GRCm38) missense possibly damaging 0.59
R2019:Ryr2 UTSW 13 11,851,188 (GRCm38) missense possibly damaging 0.59
R2060:Ryr2 UTSW 13 11,595,736 (GRCm38) missense probably damaging 1.00
R2061:Ryr2 UTSW 13 11,665,878 (GRCm38) splice site probably null
R2088:Ryr2 UTSW 13 11,662,229 (GRCm38) missense probably benign 0.04
R2089:Ryr2 UTSW 13 11,945,977 (GRCm38) missense probably benign 0.23
R2091:Ryr2 UTSW 13 11,945,977 (GRCm38) missense probably benign 0.23
R2091:Ryr2 UTSW 13 11,945,977 (GRCm38) missense probably benign 0.23
R2127:Ryr2 UTSW 13 11,712,195 (GRCm38) missense probably damaging 1.00
R2140:Ryr2 UTSW 13 11,560,607 (GRCm38) missense probably damaging 1.00
R2153:Ryr2 UTSW 13 11,577,873 (GRCm38) missense possibly damaging 0.86
R2179:Ryr2 UTSW 13 11,705,793 (GRCm38) nonsense probably null
R2207:Ryr2 UTSW 13 11,810,937 (GRCm38) missense probably damaging 1.00
R2237:Ryr2 UTSW 13 11,662,260 (GRCm38) missense probably benign 0.18
R2258:Ryr2 UTSW 13 11,738,216 (GRCm38) missense possibly damaging 0.94
R2312:Ryr2 UTSW 13 11,738,242 (GRCm38) missense probably damaging 1.00
R2421:Ryr2 UTSW 13 11,591,237 (GRCm38) missense probably damaging 0.98
R2438:Ryr2 UTSW 13 11,801,848 (GRCm38) missense probably damaging 1.00
R2483:Ryr2 UTSW 13 11,759,703 (GRCm38) missense probably damaging 1.00
R2860:Ryr2 UTSW 13 11,593,093 (GRCm38) missense probably damaging 0.98
R2861:Ryr2 UTSW 13 11,593,093 (GRCm38) missense probably damaging 0.98
R2867:Ryr2 UTSW 13 11,761,349 (GRCm38) missense probably damaging 1.00
R2867:Ryr2 UTSW 13 11,761,349 (GRCm38) missense probably damaging 1.00
R3618:Ryr2 UTSW 13 11,772,580 (GRCm38) critical splice acceptor site probably null
R3876:Ryr2 UTSW 13 11,588,159 (GRCm38) missense probably damaging 0.99
R3906:Ryr2 UTSW 13 11,738,209 (GRCm38) missense possibly damaging 0.87
R3912:Ryr2 UTSW 13 11,772,427 (GRCm38) missense probably damaging 0.99
R4018:Ryr2 UTSW 13 11,918,414 (GRCm38) missense probably damaging 1.00
R4114:Ryr2 UTSW 13 11,692,682 (GRCm38) missense probably damaging 1.00
R4119:Ryr2 UTSW 13 11,779,267 (GRCm38) missense probably benign 0.22
R4127:Ryr2 UTSW 13 11,587,437 (GRCm38) missense possibly damaging 0.91
R4222:Ryr2 UTSW 13 11,737,873 (GRCm38) missense possibly damaging 0.92
R4233:Ryr2 UTSW 13 11,750,725 (GRCm38) missense probably benign 0.20
R4355:Ryr2 UTSW 13 11,649,812 (GRCm38) missense probably benign 0.05
R4384:Ryr2 UTSW 13 11,605,233 (GRCm38) missense probably damaging 0.99
R4422:Ryr2 UTSW 13 11,717,066 (GRCm38) nonsense probably null
R4430:Ryr2 UTSW 13 11,735,527 (GRCm38) missense probably damaging 0.98
R4624:Ryr2 UTSW 13 12,106,415 (GRCm38) missense possibly damaging 0.47
R4663:Ryr2 UTSW 13 11,749,509 (GRCm38) missense possibly damaging 0.47
R4665:Ryr2 UTSW 13 11,750,685 (GRCm38) splice site probably null
R4668:Ryr2 UTSW 13 11,593,117 (GRCm38) missense probably benign
R4677:Ryr2 UTSW 13 11,706,667 (GRCm38) missense probably damaging 0.98
R4679:Ryr2 UTSW 13 11,824,369 (GRCm38) missense probably benign 0.34
R4680:Ryr2 UTSW 13 11,595,233 (GRCm38) missense probably benign 0.04
R4685:Ryr2 UTSW 13 11,692,646 (GRCm38) missense probably damaging 1.00
R4709:Ryr2 UTSW 13 11,716,998 (GRCm38) missense probably damaging 1.00
R4731:Ryr2 UTSW 13 11,577,909 (GRCm38) missense possibly damaging 0.53
R4732:Ryr2 UTSW 13 11,577,909 (GRCm38) missense possibly damaging 0.53
R4733:Ryr2 UTSW 13 11,577,909 (GRCm38) missense possibly damaging 0.53
R4734:Ryr2 UTSW 13 11,737,753 (GRCm38) missense probably damaging 0.99
R4740:Ryr2 UTSW 13 11,657,047 (GRCm38) missense possibly damaging 0.95
R4801:Ryr2 UTSW 13 11,708,227 (GRCm38) missense probably damaging 1.00
R4801:Ryr2 UTSW 13 11,687,932 (GRCm38) missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11,687,932 (GRCm38) missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11,708,227 (GRCm38) missense probably damaging 1.00
R4804:Ryr2 UTSW 13 11,717,097 (GRCm38) missense probably damaging 1.00
R4811:Ryr2 UTSW 13 11,655,698 (GRCm38) missense probably damaging 0.97
R4850:Ryr2 UTSW 13 11,745,752 (GRCm38) missense probably damaging 1.00
R4850:Ryr2 UTSW 13 11,668,820 (GRCm38) missense probably damaging 0.99
R4880:Ryr2 UTSW 13 11,752,218 (GRCm38) missense probably damaging 1.00
R4917:Ryr2 UTSW 13 11,594,986 (GRCm38) missense probably damaging 0.96
R4918:Ryr2 UTSW 13 11,594,986 (GRCm38) missense probably damaging 0.96
R4922:Ryr2 UTSW 13 11,709,963 (GRCm38) missense probably damaging 0.99
R4933:Ryr2 UTSW 13 11,945,945 (GRCm38) missense probably damaging 0.96
R4950:Ryr2 UTSW 13 11,742,011 (GRCm38) missense probably damaging 1.00
R4957:Ryr2 UTSW 13 11,785,080 (GRCm38) missense probably damaging 0.97
R4964:Ryr2 UTSW 13 11,833,992 (GRCm38) missense probably benign 0.00
R4964:Ryr2 UTSW 13 11,714,611 (GRCm38) missense possibly damaging 0.49
R4966:Ryr2 UTSW 13 11,714,611 (GRCm38) missense possibly damaging 0.49
R4966:Ryr2 UTSW 13 11,833,992 (GRCm38) missense probably benign 0.00
R4997:Ryr2 UTSW 13 11,595,306 (GRCm38) missense probably benign 0.09
R4998:Ryr2 UTSW 13 11,643,895 (GRCm38) missense probably damaging 1.00
R5033:Ryr2 UTSW 13 11,587,254 (GRCm38) missense possibly damaging 0.93
R5061:Ryr2 UTSW 13 11,635,536 (GRCm38) missense possibly damaging 0.74
R5062:Ryr2 UTSW 13 11,700,354 (GRCm38) missense probably damaging 0.97
R5088:Ryr2 UTSW 13 11,712,243 (GRCm38) nonsense probably null
R5135:Ryr2 UTSW 13 11,662,130 (GRCm38) missense probably benign 0.05
R5138:Ryr2 UTSW 13 11,660,289 (GRCm38) missense probably damaging 1.00
R5168:Ryr2 UTSW 13 11,752,321 (GRCm38) missense probably benign
R5187:Ryr2 UTSW 13 11,772,452 (GRCm38) missense probably damaging 0.99
R5197:Ryr2 UTSW 13 11,638,430 (GRCm38) critical splice donor site probably null
R5262:Ryr2 UTSW 13 11,772,437 (GRCm38) missense probably damaging 0.99
R5325:Ryr2 UTSW 13 11,690,363 (GRCm38) missense probably damaging 0.97
R5381:Ryr2 UTSW 13 11,556,658 (GRCm38) missense probably damaging 1.00
R5437:Ryr2 UTSW 13 11,655,713 (GRCm38) missense probably damaging 1.00
R5477:Ryr2 UTSW 13 11,705,656 (GRCm38) missense probably damaging 1.00
R5497:Ryr2 UTSW 13 11,705,701 (GRCm38) missense probably null 0.15
R5509:Ryr2 UTSW 13 11,745,601 (GRCm38) missense probably damaging 0.98
R5518:Ryr2 UTSW 13 11,687,909 (GRCm38) missense probably benign 0.01
R5571:Ryr2 UTSW 13 11,555,448 (GRCm38) missense possibly damaging 0.91
R5591:Ryr2 UTSW 13 11,595,014 (GRCm38) missense probably benign 0.06
R5619:Ryr2 UTSW 13 11,708,202 (GRCm38) missense probably damaging 1.00
R5630:Ryr2 UTSW 13 11,601,805 (GRCm38) missense probably damaging 1.00
R5644:Ryr2 UTSW 13 11,595,582 (GRCm38) missense probably damaging 0.99
R5667:Ryr2 UTSW 13 11,759,836 (GRCm38) missense probably damaging 1.00
R5775:Ryr2 UTSW 13 11,769,962 (GRCm38) missense probably damaging 1.00
R5836:Ryr2 UTSW 13 11,603,732 (GRCm38) missense probably damaging 1.00
R5858:Ryr2 UTSW 13 11,560,574 (GRCm38) missense probably damaging 0.99
R5934:Ryr2 UTSW 13 11,584,154 (GRCm38) missense probably damaging 0.96
R5939:Ryr2 UTSW 13 11,790,332 (GRCm38) missense probably damaging 0.99
R5941:Ryr2 UTSW 13 11,687,902 (GRCm38) missense probably damaging 1.00
R5945:Ryr2 UTSW 13 11,660,122 (GRCm38) missense probably damaging 1.00
R5946:Ryr2 UTSW 13 11,726,953 (GRCm38) missense probably damaging 1.00
R5966:Ryr2 UTSW 13 11,662,238 (GRCm38) nonsense probably null
R5974:Ryr2 UTSW 13 11,714,511 (GRCm38) splice site probably null
R6104:Ryr2 UTSW 13 11,799,825 (GRCm38) missense probably damaging 1.00
R6118:Ryr2 UTSW 13 11,792,689 (GRCm38) missense possibly damaging 0.69
R6149:Ryr2 UTSW 13 11,669,017 (GRCm38) missense probably benign
R6208:Ryr2 UTSW 13 11,895,220 (GRCm38) missense probably benign 0.04
R6217:Ryr2 UTSW 13 11,834,078 (GRCm38) missense probably damaging 1.00
R6230:Ryr2 UTSW 13 11,660,107 (GRCm38) missense probably damaging 0.99
R6279:Ryr2 UTSW 13 11,680,999 (GRCm38) missense probably damaging 0.97
R6294:Ryr2 UTSW 13 11,879,496 (GRCm38) missense probably damaging 1.00
R6300:Ryr2 UTSW 13 11,680,999 (GRCm38) missense probably damaging 0.97
R6350:Ryr2 UTSW 13 11,761,396 (GRCm38) missense probably damaging 0.98
R6484:Ryr2 UTSW 13 11,662,383 (GRCm38) missense possibly damaging 0.90
R6489:Ryr2 UTSW 13 11,834,007 (GRCm38) missense probably benign 0.29
R6548:Ryr2 UTSW 13 11,668,821 (GRCm38) missense probably damaging 1.00
R6591:Ryr2 UTSW 13 11,594,723 (GRCm38) missense probably benign 0.01
R6623:Ryr2 UTSW 13 11,710,065 (GRCm38) missense probably damaging 1.00
R6649:Ryr2 UTSW 13 11,595,643 (GRCm38) missense probably damaging 0.99
R6691:Ryr2 UTSW 13 11,594,723 (GRCm38) missense probably benign 0.01
R6770:Ryr2 UTSW 13 11,738,462 (GRCm38) missense probably damaging 1.00
R6802:Ryr2 UTSW 13 11,686,966 (GRCm38) missense probably damaging 1.00
R6809:Ryr2 UTSW 13 11,726,930 (GRCm38) missense probably damaging 1.00
R6893:Ryr2 UTSW 13 11,829,654 (GRCm38) missense possibly damaging 0.75
R6911:Ryr2 UTSW 13 11,827,559 (GRCm38) missense possibly damaging 0.50
R6915:Ryr2 UTSW 13 11,745,601 (GRCm38) missense probably damaging 1.00
R6943:Ryr2 UTSW 13 11,566,948 (GRCm38) missense possibly damaging 0.92
R6960:Ryr2 UTSW 13 11,801,243 (GRCm38) missense probably benign 0.28
R6997:Ryr2 UTSW 13 11,654,380 (GRCm38) missense possibly damaging 0.88
R6998:Ryr2 UTSW 13 11,712,166 (GRCm38) missense probably damaging 0.99
R7001:Ryr2 UTSW 13 11,794,605 (GRCm38) missense probably damaging 0.98
R7047:Ryr2 UTSW 13 11,824,400 (GRCm38) missense possibly damaging 0.64
R7089:Ryr2 UTSW 13 11,649,776 (GRCm38) missense probably benign 0.10
R7125:Ryr2 UTSW 13 11,669,987 (GRCm38) missense probably damaging 0.99
R7127:Ryr2 UTSW 13 11,655,713 (GRCm38) missense probably damaging 1.00
R7131:Ryr2 UTSW 13 11,668,811 (GRCm38) critical splice donor site probably null
R7131:Ryr2 UTSW 13 11,640,327 (GRCm38) missense possibly damaging 0.63
R7159:Ryr2 UTSW 13 11,810,908 (GRCm38) missense probably damaging 0.99
R7174:Ryr2 UTSW 13 11,801,177 (GRCm38) missense possibly damaging 0.81
R7180:Ryr2 UTSW 13 11,686,978 (GRCm38) missense probably damaging 1.00
R7182:Ryr2 UTSW 13 11,759,757 (GRCm38) missense probably benign
R7189:Ryr2 UTSW 13 11,883,123 (GRCm38) missense probably damaging 1.00
R7241:Ryr2 UTSW 13 11,665,913 (GRCm38) missense possibly damaging 0.71
R7244:Ryr2 UTSW 13 11,597,146 (GRCm38) missense probably damaging 1.00
R7326:Ryr2 UTSW 13 11,738,194 (GRCm38) missense possibly damaging 0.95
R7331:Ryr2 UTSW 13 11,745,631 (GRCm38) missense probably benign
R7365:Ryr2 UTSW 13 11,640,275 (GRCm38) missense probably damaging 0.99
R7372:Ryr2 UTSW 13 11,680,999 (GRCm38) missense probably damaging 0.97
R7395:Ryr2 UTSW 13 11,785,111 (GRCm38) missense probably damaging 0.98
R7404:Ryr2 UTSW 13 11,735,620 (GRCm38) missense probably damaging 0.97
R7417:Ryr2 UTSW 13 11,556,748 (GRCm38) splice site probably null
R7425:Ryr2 UTSW 13 11,705,644 (GRCm38) missense probably benign 0.20
R7444:Ryr2 UTSW 13 11,555,463 (GRCm38) missense probably benign 0.25
R7456:Ryr2 UTSW 13 11,752,282 (GRCm38) missense probably benign
R7460:Ryr2 UTSW 13 11,705,710 (GRCm38) missense probably benign 0.10
R7474:Ryr2 UTSW 13 11,594,876 (GRCm38) missense probably benign 0.04
R7543:Ryr2 UTSW 13 11,638,431 (GRCm38) critical splice donor site probably null
R7549:Ryr2 UTSW 13 11,737,985 (GRCm38) missense probably benign 0.15
R7558:Ryr2 UTSW 13 11,799,825 (GRCm38) missense probably damaging 1.00
R7565:Ryr2 UTSW 13 11,560,653 (GRCm38) missense possibly damaging 0.84
R7627:Ryr2 UTSW 13 11,761,327 (GRCm38) missense possibly damaging 0.65
R7698:Ryr2 UTSW 13 11,761,315 (GRCm38) missense possibly damaging 0.94
R7702:Ryr2 UTSW 13 11,690,333 (GRCm38) missense probably damaging 0.99
R7719:Ryr2 UTSW 13 11,730,343 (GRCm38) missense possibly damaging 0.94
R7772:Ryr2 UTSW 13 11,751,011 (GRCm38) missense probably benign
R7797:Ryr2 UTSW 13 11,801,180 (GRCm38) missense probably damaging 0.99
R7829:Ryr2 UTSW 13 11,827,607 (GRCm38) missense possibly damaging 0.81
R7855:Ryr2 UTSW 13 11,706,623 (GRCm38) nonsense probably null
R7872:Ryr2 UTSW 13 11,595,724 (GRCm38) missense probably damaging 1.00
R7908:Ryr2 UTSW 13 11,792,748 (GRCm38) missense probably benign 0.01
R7929:Ryr2 UTSW 13 11,594,794 (GRCm38) missense probably damaging 1.00
R7929:Ryr2 UTSW 13 11,690,295 (GRCm38) nonsense probably null
R7952:Ryr2 UTSW 13 11,646,427 (GRCm38) splice site probably null
R8008:Ryr2 UTSW 13 11,657,094 (GRCm38) missense probably benign 0.30
R8011:Ryr2 UTSW 13 11,588,140 (GRCm38) critical splice donor site probably null
R8097:Ryr2 UTSW 13 11,945,995 (GRCm38) missense probably damaging 0.98
R8133:Ryr2 UTSW 13 11,603,698 (GRCm38) missense probably damaging 1.00
R8253:Ryr2 UTSW 13 11,827,553 (GRCm38) missense possibly damaging 0.94
R8278:Ryr2 UTSW 13 11,595,506 (GRCm38) nonsense probably null
R8351:Ryr2 UTSW 13 11,799,832 (GRCm38) missense probably damaging 0.98
R8401:Ryr2 UTSW 13 11,668,935 (GRCm38) missense possibly damaging 0.95
R8403:Ryr2 UTSW 13 11,684,478 (GRCm38) missense possibly damaging 0.95
R8431:Ryr2 UTSW 13 11,659,008 (GRCm38) missense probably benign 0.00
R8509:Ryr2 UTSW 13 11,577,778 (GRCm38) critical splice donor site probably null
R8551:Ryr2 UTSW 13 11,560,593 (GRCm38) missense possibly damaging 0.93
R8684:Ryr2 UTSW 13 11,687,989 (GRCm38) missense probably damaging 0.99
R8735:Ryr2 UTSW 13 11,686,947 (GRCm38) missense probably damaging 0.97
R8766:Ryr2 UTSW 13 11,668,969 (GRCm38) missense probably damaging 0.97
R8817:Ryr2 UTSW 13 11,735,623 (GRCm38) missense possibly damaging 0.95
R8827:Ryr2 UTSW 13 11,558,048 (GRCm38) missense possibly damaging 0.80
R8884:Ryr2 UTSW 13 11,779,266 (GRCm38) missense probably benign 0.19
R8889:Ryr2 UTSW 13 11,785,104 (GRCm38) missense probably damaging 0.99
R8891:Ryr2 UTSW 13 11,799,882 (GRCm38) missense probably damaging 1.00
R8979:Ryr2 UTSW 13 11,595,038 (GRCm38) missense probably benign 0.00
R9013:Ryr2 UTSW 13 11,603,732 (GRCm38) missense probably damaging 0.98
R9040:Ryr2 UTSW 13 11,594,786 (GRCm38) missense probably damaging 0.97
R9044:Ryr2 UTSW 13 11,738,103 (GRCm38) nonsense probably null
R9056:Ryr2 UTSW 13 11,595,931 (GRCm38) missense possibly damaging 0.94
R9084:Ryr2 UTSW 13 11,601,838 (GRCm38) missense probably damaging 1.00
R9113:Ryr2 UTSW 13 11,603,855 (GRCm38) intron probably benign
R9125:Ryr2 UTSW 13 11,654,406 (GRCm38) missense probably benign 0.28
R9148:Ryr2 UTSW 13 11,885,538 (GRCm38) missense probably benign 0.02
R9210:Ryr2 UTSW 13 11,829,674 (GRCm38) missense probably damaging 0.99
R9212:Ryr2 UTSW 13 11,829,674 (GRCm38) missense probably damaging 0.99
R9233:Ryr2 UTSW 13 11,595,886 (GRCm38) missense possibly damaging 0.77
R9254:Ryr2 UTSW 13 11,883,116 (GRCm38) missense probably damaging 1.00
R9262:Ryr2 UTSW 13 11,750,968 (GRCm38) missense probably damaging 0.97
R9275:Ryr2 UTSW 13 11,883,090 (GRCm38) missense probably benign 0.10
R9278:Ryr2 UTSW 13 11,883,090 (GRCm38) missense probably benign 0.10
R9309:Ryr2 UTSW 13 11,706,692 (GRCm38) missense probably damaging 0.99
R9379:Ryr2 UTSW 13 11,883,116 (GRCm38) missense probably damaging 1.00
R9409:Ryr2 UTSW 13 11,681,087 (GRCm38) missense probably damaging 0.99
R9429:Ryr2 UTSW 13 11,794,573 (GRCm38) missense probably damaging 0.97
R9445:Ryr2 UTSW 13 11,772,577 (GRCm38) missense probably damaging 1.00
R9464:Ryr2 UTSW 13 11,737,794 (GRCm38) missense probably benign 0.00
R9467:Ryr2 UTSW 13 11,556,604 (GRCm38) missense possibly damaging 0.70
R9546:Ryr2 UTSW 13 11,587,215 (GRCm38) critical splice donor site probably null
R9562:Ryr2 UTSW 13 11,745,218 (GRCm38) missense probably damaging 1.00
R9609:Ryr2 UTSW 13 11,668,962 (GRCm38) missense probably damaging 1.00
R9704:Ryr2 UTSW 13 11,722,760 (GRCm38) missense probably damaging 1.00
R9764:Ryr2 UTSW 13 11,687,049 (GRCm38) missense possibly damaging 0.67
R9772:Ryr2 UTSW 13 11,594,899 (GRCm38) missense probably benign 0.13
R9776:Ryr2 UTSW 13 11,692,713 (GRCm38) missense probably damaging 0.98
S24628:Ryr2 UTSW 13 11,869,156 (GRCm38) missense probably damaging 0.97
X0019:Ryr2 UTSW 13 11,703,501 (GRCm38) missense probably benign 0.04
Z1176:Ryr2 UTSW 13 11,643,803 (GRCm38) critical splice donor site probably null
Z1176:Ryr2 UTSW 13 11,598,611 (GRCm38) critical splice acceptor site probably null
Z1176:Ryr2 UTSW 13 11,794,549 (GRCm38) nonsense probably null
Z1177:Ryr2 UTSW 13 11,750,873 (GRCm38) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TAAAAGTGTCTGTGCCTGGG -3'
(R):5'- AGACGGTGCCACTTTGTTTTC -3'

Sequencing Primer
(F):5'- GTGCCTGGGTCTCTCTCACAC -3'
(R):5'- TTTCTAGAGCACCACAGAGTG -3'
Posted On 2021-12-30