Phenotypic Mutation 'hamel' (pdf version)
List |< first << previous [record 25 of 74] next >> last >|
Allelehamel
Mutation Type critical splice donor site (1 bp from exon)
Chromosome11
Coordinate54,480,685 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Fnip1
Gene Name folliculin interacting protein 1
Synonym(s) A730024A03Rik
Chromosomal Location 54,438,199-54,518,235 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the folliculin-interacting protein family. The encoded protein binds to the tumor suppressor folliculin and to AMP-activated protein kinase (AMPK) and be involved in cellular metabolism and nutrient sensing by regulating the AMPK-mechanistic target of rapamycin signaling pathway. A homologous binding partner of this protein, folliculin-interacting protein 2, has similar binding activities and may suggest functional redundancy within this protein family. Both folliculin-interacting proteins have also been shown to bind the molecular chaperone heat shock protein-90 (Hsp90) and they may function as a co-chaperones in the stabilization of tumor suppressor folliculin which is a target of Hsp90 chaperone activity. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for an ENU-induced or targeted allele exhibit arrested B cell development at the pre-B cell stage with increased B cell apoptosis. [provided by MGI curators]
Accession Number

Ncbi RefSeq:  NM_173753.4; MGI:2444668

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Ref Sequences
Ensembl: ENSMUSP00000049026 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
low complexity region 93 110 N/A INTRINSIC
low complexity region 340 353 N/A INTRINSIC
low complexity region 1076 1088 N/A INTRINSIC
Phenotypic Category
Phenotypequestion? Literature verified References
hematopoietic competition - disadvantage
hematopoietic system
homeostasis/metabolism
muscle
Penetrance  
Alleles Listed at MGI

All alleles(3) : Targeted(1) Gene trapped(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Fnip1 APN 11 54499508 missense probably damaging 1.00
IGL01590:Fnip1 APN 11 54493300 missense probably damaging 1.00
IGL01959:Fnip1 APN 11 54490912 missense possibly damaging 0.95
IGL02157:Fnip1 APN 11 54487763 missense probably damaging 1.00
IGL02197:Fnip1 APN 11 54493374 missense probably damaging 1.00
IGL02476:Fnip1 APN 11 54499567 splice site probably benign
IGL02639:Fnip1 APN 11 54475640 nonsense probably null
IGL02742:Fnip1 APN 11 54493351 missense probably damaging 1.00
hamel2 UTSW 11 54502271 missense probably damaging 1.00
H8562:Fnip1 UTSW 11 54480297 missense probably damaging 0.98
P0043:Fnip1 UTSW 11 54503225 missense probably benign 0.00
R0114:Fnip1 UTSW 11 54487801 splice site probably benign
R0278:Fnip1 UTSW 11 54489343 splice site probably null
R0409:Fnip1 UTSW 11 54480354 splice site probably null
R0840:Fnip1 UTSW 11 54493181 splice site probably benign
R1131:Fnip1 UTSW 11 54493303 missense possibly damaging 0.82
R1205:Fnip1 UTSW 11 54502306 missense possibly damaging 0.91
R1271:Fnip1 UTSW 11 54503297 missense probably benign
R1817:Fnip1 UTSW 11 54502453 missense probably benign 0.30
R1826:Fnip1 UTSW 11 54466164 missense probably damaging 1.00
R1872:Fnip1 UTSW 11 54487735 missense probably damaging 1.00
R1883:Fnip1 UTSW 11 54515547 missense probably damaging 1.00
R1917:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R1918:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R1919:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R2010:Fnip1 UTSW 11 54482503 missense probably damaging 1.00
R2117:Fnip1 UTSW 11 54500624 missense probably damaging 1.00
R2329:Fnip1 UTSW 11 54466107 missense probably damaging 0.98
R2337:Fnip1 UTSW 11 54475737 missense probably damaging 0.98
R2850:Fnip1 UTSW 11 54502677 missense probably benign 0.32
R2863:Fnip1 UTSW 11 54502424 missense probably damaging 1.00
R2864:Fnip1 UTSW 11 54502424 missense probably damaging 1.00
R2865:Fnip1 UTSW 11 54502424 missense probably damaging 1.00
R3936:Fnip1 UTSW 11 54480239 splice site probably null
R4017:Fnip1 UTSW 11 54509987 missense probably benign 0.14
R4033:Fnip1 UTSW 11 54502471 missense probably benign 0.02
R4668:Fnip1 UTSW 11 54503559 missense probably damaging 1.00
R4695:Fnip1 UTSW 11 54499419 missense probably damaging 1.00
R4762:Fnip1 UTSW 11 54466171 missense probably damaging 1.00
R4762:Fnip1 UTSW 11 54499526 missense probably benign 0.01
R4777:Fnip1 UTSW 11 54500556 missense probably damaging 1.00
R4863:Fnip1 UTSW 11 54515556 missense possibly damaging 0.52
R5369:Fnip1 UTSW 11 54502589 missense probably benign
R5481:Fnip1 UTSW 11 54502644 missense probably benign 0.01
R5562:Fnip1 UTSW 11 54489342 critical splice donor site probably null
R5563:Fnip1 UTSW 11 54504862 missense probably benign 0.05
R5628:Fnip1 UTSW 11 54503633 missense probably benign 0.08
R5689:Fnip1 UTSW 11 54502289 missense probably damaging 1.00
R6009:Fnip1 UTSW 11 54502271 missense probably damaging 1.00
R6120:Fnip1 UTSW 11 54510000 missense probably benign 0.23
R6429:Fnip1 UTSW 11 54515567 missense probably damaging 1.00
R6546:Fnip1 UTSW 11 54502611 missense probably benign 0.03
R6600:Fnip1 UTSW 11 54503099 missense probably benign
R6882:Fnip1 UTSW 11 54509898 missense probably damaging 1.00
R6966:Fnip1 UTSW 11 54482559 missense probably benign 0.00
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, Sperm
Repository
Last Updated 2018-06-15 1:20 PM by Diantha La Vine
Record Created 2011-02-11 2:47 PM by Owen M. Siggs
Record Posted 2016-07-11
Phenotypic Description
Figure 1. Recessive B-cell deficiency associated with a splice donor variant in Fnip1. Identification of the hamel phenotype.
Figure 2. An early block in B-cell development and a gene dose-sensitive MZ B-cell deficiency. Frequencies of major B-cell subsets in bone marrow, peritoneum, and spleen. Figure adapted from (1).
Figure 3. An early block in B-cell development and a gene dose-sensitive MZ B-cell deficiency. Reduced frequency of IgMhi cells in Fnip1+/ham heterozygotes (n = 3). Figure adapted from (1).
Figure 4. An early block in B-cell development and a gene dose-sensitive MZ B-cell deficiency. Absolute numbers of transitional (T1, CD93+CD23; T2, CD93+CD23+IgMint; T3, CD93+CD23+IgMhi;), follicular (CD21/35intCD23hi), MZP, or MZ B cells in spleen. Figure adapted from (1).
Figure 5. Cardiac phenotype associated with the Fnip1 mutation. Macroscopic appearance of heart and skeletal muscle of adult wild-type and Fnip1 mutant mice. Heart and body weight of 6-wk-old female mice are represented in the lower image. Figure adapted from (1).

The hamel phenotype was found in N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice during a screen to identify genes required for lymphocyte development (1). Homozygous hamel mice exhibited repopulation of the CD19+ B-cell compartment by CD45.1+ donor-derived cells (Figure 1), indicating a cell-intrisic defect in the ability of hematopoietic precursors to repopulate the CD19+ B cell compartment. The defect was not observed in the CD4+, CD8+, NK1.1+, or CD11b+ compartments. B cells were absent from the peritoneum and spleen in the hamel homozygotes (Figure 2). B220+ splenocytes from heterozygous hamel mice exhibited a reduced frequency of IgM+ cells (Figure 3). Both the frequency and absolute numbers of CD21/35hiIgMhi or CD21/35hiCD23lo cells were reduced in the marginal zone (MZ) and MZ precursor compartments (Figure 4); transitional and follicular B-cell subsets were not affected.

 

The hearts of homozygous hamel mice were enlarged although the overall body weight was not different than wild-type mice (Figure 5A) (1). In addition, homozygous hamel skeletal muscle was darker than that in wild-type mice (Figure 5A). Left ventricular mass was elevated in the homozygous hamel mice, while the internal end-diastolic dimension was comparable to that in wild-type mice (Figure 5B). Taken together, the cardiac enlargement was principally due to hypertrophy as opposed to chamber dilatation.

Nature of Mutation
Figure 6. Recessive B-cell deficiency associated with a splice donor variant in Fnip1. Simulated LOD score generated by chromosomal mapping. Figure adapted from (1).
Figure 7. Capillary-sequencing trace of a splice donor variant in Fnip1 (yellow highlight).

The hamel mutation was mapped using bulk segregation analysis (BSA) of F2 offspring, with C57BL/10J as the mapping strain (1). The mutation showed strongest linkage with marker B10SNPS0170 at base pair 65,237,281 on chromosome 11 (synthetic LOD = 3.6) (Figure 6). Whole genome SOLiD sequencing of a homozygous hamel mouse and validation by capillary sequencing identified a G to A transition at base pair 54,294,187 (Figure 7), 10.9 Mb from the marker of peak linkage, on chromosome 11 in the Genbank genomic region NC_000077.5 encoding the Fnip1 gene. The mutation is within the donor splice site in intron 5, one nucleotide after exon 5 (out of 18 total exons).

         <--EXON 4   <--EXON 5 INTRON 5--> EXON 6 -->

541……TTCATCAGATCCG……GTCTCAATAC gtaagtgc…… TCTGCAGGACAGTC……

148……I--H--Q--I--R……S--L--N--T            --L--Q--D--S--……
        CORRECT      DELETED                 CORRECT      

         <--EXON 4  EXON 6 -->
541……TTCATCAGATCCG TCTGCAGGACAGTC……
148……I--H--Q--I--G --L--Q--D--S--…… 

              ABERRANT

                        

 

 

 

 

 

 

 

 

 

 

 

 

The mutated nucleotide is indicated in red; the splice donor sequence is shown in blue.

 

Figure 8. Recessive B-cell deficiency associated with a splice donor variant in Fnip1. Fnip1 BM cDNA PCR amplification and sequencing, demonstrating the presence of two major alternate splice products in Fnip1 homozygous mutants. Figure adapted from (1).

Two aberrant Fnip1 splice products were detected across exons 3-7 in hamel bone marrow; processing of Fnip1 exons 1-4 were similar between wild-type and hamel (Figure 8) (1). The smaller of the two splice products lacked exon 5 (leading to an in-frame deletion of 25 amino acids). A protein product of the exon 5 deletion splice variant was not detected by Western blotting. The larger product incorporated 37 base pairs of intron 5 before using a cryptic splice site, which created a premature stop codon.

Protein Prediction

Figure 9. Alignment of the five conserved domains of FNIP1 There are five blocks of conserved amino acid sequence with at least 35% similarity between FNIP1 orthologs in Homo sapiensXenopus tropicalisDanio rerioDrosophila melanogaster, and Caenorhabditis elegans.  The mouse sequences within the conserved regions are homologous to the human sequence with the exception that the mouse FNIP1 is one amino acid shorter (1165 aa) than the human (1166 aa).  The hamel mutation is noted in intron 5. Other mutations found in FNIP1 are noted. Click on each mutation for more information. Adapted from (1).

Fnip1 encodes the 1,165 amino acid folliculin (FLCN)-interacting protein 1 (FNIP1) protein. FNIP1 shares 49% identity and 74% similarity with FNIP2, another highly conserved member of the FLCN-interacting protein family (2;3). The sequences of human FNIP1 and FNIP2 are most similar at their N-termini and within a 158 amino acid region of their C-termini (3). BLAST and SMART analysis revealed no known functional domains in FNIP1; however, there are five blocks of conserved amino acid sequence with at least 35% similarity between FNIP1 orthologs in Homo sapiens, Xenopus tropicalis, Danio rerio, Drosophila melanogaster, and Caenorhabditis elegans (Figure 9). Amino acids 300-1166 of FNIP1 (containing all but the first conserved block) are essential for binding to the C-terminus of FLCN; the full-length FNIP1 protein is required for maximum binding (4). FNIP2 contains the five blocks of amino acids conserved in FNIP1 orthologs (2).

 

FNIP1 and FNIP2 are predicted to form homodimers (3). Studies have shown conflicting findings on whether FNIP1 and FNIP2 can form heterodimers with each other (2;3). In addition to FLCN (and putatively FNIP2), FNIP1 interacts with HSP90, as well as with the alpha, beta, and gamma subunits of 5’-AMP-activated protein kinase (AMPK) (see “Background” for more details about these proteins) (4). AMPK phosphorylates FNIP1, and AMPK inhibitors inhibit this phosphorylation in a dose-dependent manner; the reduction in FNIP1 phosphorylation leads to reduced FNIP1 expression (4).

 

The hamel mutation affects the first nucleotide of intron 5. Exon 5 encodes part of the first conserved block of amino acids. The hamel mutation could result in the loss of amino acids necessary for FLCN interaction. FNIP1 is a scaffold for FLCN, and changes in the conformation and/or expression of FNIP1 could alter the function of FLCN.

Expression/Localization

RT-PCR ELISA detected FNIP1 in all human adult and fetal tissues; highest expression was observed in spleen, testis, ovary, and liver (5). Northern blot analysis in another study detected the strongest expression of FNIP1 in heart, liver, and placenta with lower expression in the kidney and lung (4). A third study using quantitative real-time RT-PCR (qRT-PCR) detected FNIP1 in most human tissues with highest expression in the salivary gland, nasal mucosa, parathyroid gland, and muscle (3). In mouse tissues, Fnip1 is expressed in testes, kidney, skeletal muscle, liver, heart, embryo, thymus, spleen, and bone marrow (6). In addition, Fnip1 is expressed in B lineage cells throughout B cell development (6). Fnip1 is also expressed in thymocytes, although it is not differentially regulated during T cell development (6).

 

FNIP1 colocalizes with FLCN in the cytoplasm in a reticular pattern and it is proposed that FNIP1 regulates this distribution (2;4;6). The reticular pattern of FNIP1/FLCN suggests that this complex may associate with membranous components (2). In HeLa cells, FNIP1, FNIP2, and FLCN are enriched in membrane fractions although smaller amounts of FNIP1 were detected in other fractions (2). FNIP1 displays an expression pattern similar to those of FLCN and FNIP2 in several tissues including muscle, nasal mucosa, salivary glands, and uvula (3). However, FNIP1 is expressed at lower levels than FNIP2 in the pancreas and higher levels than FNIP2 in the parathyroid gland (3). The differential expression pattern of FNIP1 and FNIP2 in these tissues suggests tissue-specific functions for FNIP1 and FNIP2 as well as that the ratio of FNIP1 to FNIP2 expression affects the functions of these proteins or their dimers (3).

Background

FNIP1 and mTOR

FNIP1 was identified by virtue of its interaction with FLCN. Similar to FNIP1, FLCN is highly conserved across species and lacks known structural or sequence motifs (3;7;8). It was proposed that FNIP1 acts as a scaffold for FLCN to facilitate the phosphorylation of FLCN downstream of AMPK signaling (4). FNIP1 overexpression promoted the phosphorylation of FLCN, whereas rapamycin treatment and amino acid starvation, both of which inhibit mammalian target of rapamycin (mTOR), reduced FNIP1-mediated phosphorylation of FLCN (4). Furthermore, in FNIP1 siRNA-treated cells, there was a decrease in total levels of the serine/threonine kinase mTOR with a corresponding decrease in the level of phosphorylated mTOR (2). Modulation of the interaction between FLCN and FNIP1 by rapamycin and nutrient load suggests that FLCN and FNIP1 proteins are both involved in energy and/or nutrient sensing through AMPK and mTOR signaling pathways (4). It is proposed that complex formation between FNIP2 and FLCN may prevent the dephosphorylation of FLCN, although the role of phosphorylation of either of these proteins is not known (2).

 

Figure 10.  mTOR signaling.  mTOR signaling and subsequent mTOR-mediated regulation of cell growth can be stimulated by exposure to growth factors (e.g. insulin), nutrients, and energy (activation through Fc receptor binding in the B cell is shown).  mTOR is present in two complexes: mTORC1 and mTORC2.  The mTORC1 complex promotes cellular growth or catabolic processes when conditions are favorable or unfavorable, respectively.  PI3K signals mTORC1 via Akt, which inactivates TSC to prevent inibition of mTORC1.  AMPK-dependent activation of TSC2 reduces mTORC1 signaling.  mTORC1 mediates several downstream effects in the cell including suppression of autophagy, activation of transcription leading to mitochondrial metabolism, increased protein synthesis, proliferation, and growth factor production; the mTORC1 pathway is sensitive Rapamycin.  The mTORC2 complex promotes cell survival through the activation of Akt and SGK.  mTORC2 can also regulate actin cytoskeleton organization through PKC.  See the text for more details.

FIgure 11. mTOR signaling and adaptive immunity. There are several environmental factors that can initiate the mTOR signaling pathway to direct an adaptive immune response.  The T cells (CD4+ and CD8+), antigen-presenting cells (APCs), and B cells each play a role in the adaptive immune response.   mTOR signaling has a role in the differentiation, activation, and function of the cells shown.

The mTOR-associated signaling pathway regulates cell growth, size, metabolism, and growth factor signaling by stimulating protein synthesis (Figure 10(4). When there are sufficient nutrients, mTOR signaling is active allowing for protein synthesis and an increase in cell size (9-11). In contrast, when nutrient levels decrease or in conditions of cell stress, protein synthesis is inhibited with a concomitant decrease in cell size and cell proliferation (9;10). The activation of growth factor receptor tyrosine kinases leads to the activation of phosphatidylinositol 3-kinase (PI3K), an upstream activator of mTOR, which subsequently activates Akt (12). mTOR activity is then regulated through the Akt-mediated phosphorylation of tumor suppressors TSC1 and TSC2 (3;10;12). The highly conserved serine/threonine kinase AMPK complex is suggested to also function as a TSC kinase and associates with FNIP1 (13-16). In response to a metabolic need, AMPK stimulates energy production (e.g. glucose and lipid catabolism) or inhibits energy consumption (e.g. by the inhibition of protein, fatty acid, and cholesterol synthesis) (15).

 

mTOR can be incorporated into both the mTORC1 and mTORC2 complexes (11;17;18). In the mTORC1 complex, mTOR interacts with raptor, PRAS40, Deptor, and mLST8 to target proteins in a rapamycin-sensitive manner (11;18). The phosphorylation of TSC2 by Akt inactivates the GTPase activating protein (GAP) activity of TSC2, allowing the protein Rheb to remain in a GTP-bound state (12). Rheb-GTP subsequently binds and activates the mTOR kinase domain through an unknown mechanism (12). Rapamycin inhibits the assembly of the mTORC1 complex by associating with the cellular protein FKBP12, which subsequently binds mTOR (11;18;19). When mTORC1 is activated upon raptor binding to mTOR, it phosphorylates several targets, including S6 kinase 1 (S6K1) and 4E-binding protein 1 (4E-BP1) (18;20). S6K1, in addition to S6K2, is a kinase that phosphorylates S6, a component of the small (40S) ribosomal subunit (11). siRNA-mediated downregulation of FLCN, FNIP1, or FNIP2 leads to a decrease in S6K1 phosphorylation (2). In the mTORC2 complex, mTOR interacts with rictor, mLST8, SIN-1, PRR5/Proctor, PRR5L, and DEPTOR (21). The mTORC2 complex mediates actin cytoskeleton reorganization and cell migration via PKC phosphorylation as well as protein synthesis and maturation, autophagy, and metabolism through activation of Akt (12;21). It is proposed that mTORC2 is activated by growth factors through an Akt-independent manner (12). In contrast to mTORC1 activation, the mechanism of mTORC2 activation is not completely understood. Only under conditions of prolonged rapamycin treatment the association of rictor and mTOR is inhibited, preventing the assembly of the mTORC2 complex. As a result, there is a decrease in Akt phosphorylation (18;22).

  

mTOR signaling regulates the differentiation, activation, and function of several immune cell types including mast cells, neutrophils, natural killer cells, γδ T cells, macrophages, dendritic cells (DCs), T cells and B cells (Figure 11) [(18;23-25); reviewed in (26)]. In immune cells, mTOR is regulated by several environmental cues (26). In T cells, mTOR activity can be inhibited by the binding of the coinhibitor PD-1 ligand 1 to PD-1 on the T cell surface (27). In addition, PI3K-mediated activation of IL-2 and IL-4 can activate mTORC1 activity (28;29)

 

The role of mTOR in T cells has been extensively studied. mTOR can mediate the production of IL-2 by controlling the activation of NF-κB by the T-cell costimulatory molecule, CD28 (12;30;31). In mice that have mTOR selectively deleted in T cells there were normal amounts of T cell subsets in the periphery (32). Hypomorphic mTOR mice had a decrease in total thymocyte numbers, but T cell development was not affected (33). mTOR was not required for CD4+ T cell proliferation, but was essential for CD4+ T cells to differentiate to Th1, Th17, or Th2 effector cells. The mTOR-deficient T cells, instead, generated Foxp3+ T cells. Selective inhibition of either the mTORC1 or mTORC2 complexes determined that inhibition of mTORC1 resulted in T cells that did not differentiate into Th1 or Th17 cells (9;34). Selective deletion of mTORC2 signaling found that CD4+ T cells were unable to differentiate into Th2 cells (34;35). Inhibition of both pathways was essential for enhanced generation of Tregs (Foxp3+). In CD8+ T cells, deletion of the mTORC1 inhibitor TSC2 led to enhanced effector generation. Also, loss of mTORC1 signaling led to an inability of CD8+ T cells to become effector cells. Subsets of T cells (e.g. conventional and regulatory αβ T cells) rely on mTOR signaling for survival (36). In mouse skin, mTOR signaling is required for activation-induced proliferation of γδ T cells along with cytokine production and migration; impaired mTOR signaling was not essential for γδ T cell survival (36). mTOR signaling may be necessary for trafficking of peripheral αβ T cells (37;38). mTOR is implicated in trafficking and the circulation of peripheral T cells in that mTOR downregulates adhesion molecule CD62L and chemokine receptor CCR7 on naïve mouse CD8+ T cells upon activation, a process necessary to allow newly activated T cells to traffic out of secondary lymphoid organs and enter the periphery (18;39)

 

In antigen presenting cells (APCs), the inhibition of mTOR in plasmacytoid DCs (pDCs) decreases the production of type I interferons in response to TLR-9 (see the record for CpG1) CpG DNA by changing the composition of signaling proteins on the endosomes where the TLR9 is expressed thereby preventing the association with the signaling protein, IRF-7 (9;40). In addition, mTOR regulates dendritic cell maturation.

 

Marginal zone B cells have high mTOR activity in response to nutrients in the absence of mitogens, while follicular B cells have lower, basal levels of mTOR activity (26). A role for mTOR in regulating IL-7 signaling at the pro-B cell stage has been established (41). The deletion of a member of the mTORC2 complex, SIN1, enhanced IL-7R expression and pro-B cell survival (42). In mature B cells, mTOR is activated in response to TLR and B-cell receptor (BCR) ligation downstream of the P13K/Akt signaling pathway (41). In a mTOR mutant mouse model, B cell development was more strongly affected by changes in mTOR signaling than T cell development (33). In the spleen and bone marrow, the numbers and percentages of B220+ B cells were reduced (33). Furthermore, the sizes of splenic and lymph node B220+ B cells in the mTOR mutant mice were smaller (33). Analysis of the B cell population indicated that B-cell development was blocked at the transition between large and small pre-B cells (33). In the mTOR mutant spleen, there were more mature B cells, but less transitional, marginal zone, and follicular B cells; T2 B cells were not changed (33). The mTOR mutant B cells were not able to efficiently migrate in response to chemokines, indicating that the increase in the mature B cell percentage was due to poor trafficking of the B cells (33). This study found that normal mTOR levels were essential for B-cell signaling through the BCR and TLR receptors as well as CD40 (see walla for Cd40lg) ligation; the BCR and CD40 signaling effects were more severe as there was proliferation noted in response to LPS (33). Antigen-specific IgG antibody production was lower in mTOR mutant mice immunized with both T-independent and T-dependent antigens. Taken together, changes in the level of mTOR can affect B cell development, differentiation, trafficking and/or homeostasis (33). Also, upon the loss of mTOR, the innate immune response is more intact than the adaptive immune response (33). A mouse model with hyperactive mTORC1 activity exhibited impaired B cell maturation and a reduction in marginal zone B cells (41). T-dependent and-independent antibody production were decreased (41).

 

FNIP1 and Hsp90

Heat shock proteins (HSPs) (e.g. Hsp70, Hsp90, and Hsp60) act as chaperones within multiprotein complexes that stabilize proteins within the cell (43-46). During normal cellular conditions as well as under conditions of stress (e.g. hypoxia, radiation, calcium increase, glucose deprivation, cancer, and microbial infection), HSPs protect proteins from aggregation and misfolding, aid in transport across membranes, mediate conformational changes, assist the formation of multimeric complexes, and alter the substrate activity of proteins by binding to hydrophobic sites on nascent polypeptides (44-48).

 

Hsp90 co-immunoprecipitated with HA-tagged FNIP1 expressed in HEK293 cells (4); further characterization of this interaction has not been reported. The Hsp90 family consists of Hsp90a and Hsp90b (both cytosolic) as well as the ER protein, gp96 (45;46;49;50). Hsp90 target proteins include transcription factors (e.g. nuclear receptors for steroid hormones), kinases, telomerase, and viral replication proteins (51).

 

Hsp90 family members have been implicated in both adaptive and innate immune responses (45;46;49). In the adaptive immune response, the interaction of HSPs with antigen presenting cells (APCs) generates a robust T-cell response against even the smallest amounts of HSP-chaperoned antigenic peptides (45). Once at the APC, the HSP-peptide complex undergoes rapid receptor-mediated endocytosis (52;53). Once the complex is internalized, the peptide is subsequently presented to, and recognized by, T-cells as a peptide-MHC class I complex (54;55). In the innate immune response, Hsp90 and gp96 can induce macrophages and dendritic cells (DCs) to produce proinflammatory cytokines, such as IL-1β, TNFα, IL-12, and GM-CSF (46;47;56) as well as chemokines, including MCP-1, MIP-1 and RANTES (57-59). HSPs can also induce DC maturation via upregulation of molecules such as CD86 and CD40, and promote their accumulation in the draining lymph node (46;56;60;61). In addition to the role of Hsp90 family members in adaptive and innate immune responses, Hsp90 is required for the replication of several viruses (e.g. hepatitis B and C, cytomegalovirus, and influenza A) as well as the folding and maturation of capsid proteins (51;62).

Putative Mechanism

Fnip1 knockout (KO) mice are viable and fertile, but they display a marked reduction in spleen size as well as an almost complete lack of conventional splenic CD19+ cells, B220lowCD19high peritoneal B1 cells, and B cells in the bone marrow with a concomitant accumulation of B220lowCD43+CD25−pro-B cells (63). Thymus size, thymocyte numbers, and peripheral T cells as well as bone marrow monocyte, granulocyte, and erythrocyte lineages were normal in the Fnip1 KO animals. The reduced cell numbers were due to increased cell death of peripheral pro-B and pre-B cells in the KO; overexpression of antiapoptoic protein Bcl2 in the B cell compartment led to increased B220+IgM+ B cells in the bone marrow. Taken together, these results show that FNIP1 is essential for the survival of B-cells in the bone marrow. The defect in pro-B cell development was not caused by changes in V(D)J recombination or the failure to express a functional B cell receptor.

 

An ENU-induced Fnip1 mutant with a 32 bp deletion in exon 9, which resulted in coding of a premature stop codon at amino acid 293 exhibited changes in skeletal muscle, hypertrophic cardiomyopathy, and increased liver glycogen content (6). The Fnip1 mutant mice also showed a block at the pre-B cell stage in the bone marrow. Mature B cells were not detected in the bone marrow or the spleen and B1 B lymphocytes were not found in the peritoneal and pleural cavities. This study determined that FNIP1 mediates B cell development at the large pre-B to small pre-B cell transition; no changes to the signals from the pre-BCR and IL-7 receptor were detected in the Fnip1 mutant animals. Reduced Fnip1 expression also led to metabolic imbalance, which triggered apoptosis in response to pre-BCR stimulation, nutrient deprivation, or oncogene activation. FNIP1 was proposed to act as a molecular switch that permits pre-B cell differentiation and survival and FNIP1 ensures that maturing B cells have adequate metabolic capacity to finish maturing (6).

FIgure 12.  The hamel mutation and proposed changes to mTOR signaling in B cells.  mTOR signaling is essential for the activation, maturation, differentiation, and survival of B cells (top). The hamel mutation is proposed to result in changes in an interaction between FNIP1/FLCN and/or AMPK (bottom).  The loss of the FNIP1/FLCN interaction would result in loss of inhibition on the mTORC2 complex and a subsequent Akt-mediated suppression of FoxO.  Also, there would be a reduction in the phosphoryaltion of TSC1/TSC2.  These changes to mTOR signaling would lead to impaired B cell maturation and a reduction in cell survival.  See Figure 3 for more details on mTOR signaling.

Figure 13. Elevated AMPK activity in hearts, but not hepatocytes, of Fnip1 mutants. AMPK γ1- and AMPK γ2-specific activity in neonatal heart tissue in the presence or absence of AMP. Figure adapted from (1).
Figure 14. Autophagosome formation is increased in Fnip1 mutants but is not responsible for B-cell deficiency. Bone marrow B cells were permeabilized and stained for S555 phospho-ULK1 (pULK1) and Beclin-1. Figure adapted from (1).
Figure 15. Autophagosome formation is increased in Fnip1 mutants but is not responsible for B-cell deficiency. Bone marrow cells from wild-type or Fnip1 mutant mice (with or without the EμBCL2 transgene) were stained for LC3 in the presence or absence of bafilomycin (which inhibits degradation of LC3-II expressing autophagosomes). Hardy fractions were gated as (A, B220+CD43+BP-1CD24; B, B220+CD43+BP-1CD24+; C+C′, B220+CD43+BP-1+CD24+; D, B220+CD43IgMIgD; E, B220+CD43IgMIgD+; F, B220+CD43IgM+IgD+). Figure adapted from (1).

Characterization of the hamel mouse found that, similar to the Fnip1 KO (63) and Fnip1 ENU mutant (6), FNIP1 is necessary for B cell development, skeletal muscle composition, and cardiac function (1). The FLCN/FNIP complex negatively regulates AMPK, subsequently leading to alterations in AMPK-mTOR signaling (Figure 12). mTOR signaling is essential for the activation, maturation, differentiation, and survival of B cells (26). In cardiac tissue, AMP responsivity was reduced in homozygous hamel mice. Basal activation of γ2-containing AMPK complexes was observed (Figure 13) (1). The activity and AMP responsiveness of γ1-containing AMPK complexes was comparable across genotypes. Autophagy-inducing kinase ULK1 is a downstream target oaf AMPK. The level of phosphorylated ULK1 was higher in hamel bone marrow cells compared to that in wild-type mice (Figure 14), indicating an increased rate of autophagy. In addition, staining of LC3, an auophagosome marker, was increased in hamel B cells (Figure 15). Taken together, auophagosome formation was increased in hamel mice; however, increased autophagy was not solely responsible for the block in B-cell development. How Fnip1 deficiency causes a block in B cell development is unknown. Overexpression of the antiapoptotic protein, BCL2, was able to partially rescue B cell development upon the loss of Fnip1 expression.

Primers Primers cannot be located by automatic search.
Genotyping

Hamel genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition (using the PCR primers) or by digestion with BsaAI (the restriction site is lost in the mutant). 

 

PCR (and Sequencing) Primers

Hamel (F): 5’- CTTTCATAGCTCGCCTCCAC -3’

Hamel (R): 5'- CTTAGGAGGCCCAACCTTGT -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

The following sequence of 561 nucleotides (from Genbank genomic region NC_000077.5 for linear genomic sequence of Fnip1) is amplified:

 

42421   ctttcata gctcgcctcc acagcttatg cttagcaaag ttttcaccgc acggactggc    

42481 agtagtatct gtgggagtct caatacgtaa gtgcttgtgg atgcaggggg attgatattt    

42541 aaggtacaca aagataaata ttaaagatct ttttaaatta tagcacaatt tcaactctat    

42601 atcttgctca agtttgaaag tttatggagt ccagattaca caccctttct gaatatgact    

42661 ggatatatag atgtgatttc tttttctgta gttttccaga aggtttgtta gaagcaaaat    

42721 gttgagcaca tctccatcct agatggcatg ctgcttttca gtcttactct tctgagctga    

42781 tcaccattca cacctttaca ttcttcagtg tgcagagccc cacagactcg aatggccttg    

42841 ggtagccatg tcactgttaa atcaaagtca tcccccccca cacacacaca cacactacac    

42901 atatagaata gctgtgggga gattataagc tgttctcgct tagactagaa cagtgacata    

42961 gaaacaaggt tgggcctcct aag   

 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated G is indicated in red.

References
Science Writers Anne Murray
Illustrators Victoria Webster
AuthorsOwen Siggs, Bruce Beutler & Richard Cornall
List |< first << previous [record 25 of 74] next >> last >|