Allele | cpg1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 9 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 106,225,007 bp (GRCm38) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | T ⇒ C (forward strand) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Tlr9 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | toll-like receptor 9 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 106,222,598-106,226,883 bp (+) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is preferentially expressed in immune cell rich tissues, such as spleen, lymph node, bone marrow and peripheral blood leukocytes. Studies in mice and human indicate that this receptor mediates cellular response to unmethylated CpG dinucleotides in bacterial DNA to mount an innate immune response. [provided by RefSeq, Jul 2008] PHENOTYPE: Nullizygous mice exhibit impaired immune responses to CpG DNA and altered susceptibility to EAE and parasitic infection. ENU-induced mutants may exhibit altered susceptibility to viral infection or induced colitis and impaired immune response to unmethylated CpG oligonucleotides. [provided by MGI curators] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Leucine changed to Proline | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | not available | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
PDB Structure |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000082207 Gene: ENSMUSG00000045322 AA Change: L499P
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.8857 ![]() |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Probably nonessential (E-score: 0.083) ![]() |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | CE: no linkage results | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | 100% | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All alleles(9) : Targeted, knock-out(1) Gene trapped(1) Chemically induced(7) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Semidominant | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | Embryos, Sperm, gDNA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MMRRC Submission | 010464-UCD | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2018-12-14 11:09 AM by Diantha La Vine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2007-10-18 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description | ![]() CpG1 mice are hypersusceptible to mouse cytomegalovirus (MCMV) infection, as demonstrated by a high splenic viral titer (similar to BALB/c mice) four days after intraperitoneal inoculation with 5 x 105 pfu MCMV (MCMV Susceptibility and Resistance Screen). CpG1 mice succumb by six days post-infection, when wild type mice appear healthy. CpG1 mutants also display impaired MCMV-induced cytokine production; specifically, serum levels of interferon (IFN)-α/β, IFN-γ, and IL-12p40 are significantly reduced compared to wild type when tested 36 hours after infection with 5 X 104 pfu. Likely as a consequence, CpG1 mice have a seven-fold reduction in activated splenic natural killer (NK) cells and a six-fold reduction in NKT cells compared to wild type 36 hours post-infection (as measured by intracellular IFN-γ staining) (1).
Although not all of the same phenotypes have been examined, those tested are identical between CpG1, CpG2, CpG3 and CpG5 mice. Sequence analysis revealed that all four strains contain mutations in Tlr9. However, the positions of the mutations differ, with the CpG1, CpG3 and CpG5 mutations located in the sixteenth, sixth and fourteenth extracellular leucine-rich repeats (LRR), respectively, and the CpG2 mutation located in the cytoplasmic Toll/IL-1R (TIR) domain. In addition to CpG1, CpG2, CpG3 and CpG5, another strain of mice, designated effete, also exhibits impaired TNF-α responses to CpG ODN treatment. The mutant has no TLR9 mutation; the causative mutation is under investigation.
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation | ![]() 1587 GTCAATCTCTCACGCCTCCAGTGTCTTAGCCTG
494 -V--N--L--S--R--L--Q--C--L--S--L-
The mutated nucleotide is indicated in red lettering, and causes a leucine to proline substitution at residue 499 of the TLR9 protein.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction | TLR9 is a type I integral membrane glycoprotein containing 1032 amino acids. Like the other TLRs, its cytoplasmic domain (at its C terminus) shares similarity with the interleukin-1 and IL-18 receptors (IL-1R and IL-18R) in a conserved region of approximately 200 amino acids known as the Toll/IL-1R (TIR) domain (2-4), which mediates homo- and heterotypic protein interactions during signal transduction. TIR domains in TLRs and in IL receptors contain 3 conserved boxes (boxes 1, 2 and 3), which are required for signaling (5). In addition, TIR domains contain six α-helices (αA, αB, αC, αC’, αD and αE) and five β-strands (βA, βB, βC, βD and βE) which are connected by seven loops (named for the α-helix and β-strand they connect; e.g. AA connects βA with αA). The crystal structures of the TLR1 and TLR2 TIR domains reveal that they fold into a structure with a central five-stranded parallel β-sheet surrounded by five helices (6) (see the record for languid for a picture of the TLR2 TIR domain). Many of the α-helices and connecting loops are predicted to participate in binding partner recognition, and their mutation is expected to abrogate specific binding interactions. This is true of a proline to histidine mutation in the BB loop of TLR4 (see the record for lps3), which has been reported to abolish MyD88 binding to a constitutively active TLR4 mutant (7) and LPS-induced signaling in mice (8).
The extracellular domains of TLRs, unlike those of the interleukin receptors, contain multiple leucine-rich repeats (LRRs), which mediate ligand recognition by TLRs and consist of 24-29 amino acids with two conserved leucine-rich sequences: XLXXLXLXXN (residues 1-10, present in all LRR subtypes) followed by XØXXØX4FXXLX (residues ~11-24, but variable in length, sequence and structure), where X is any amino acid and Ø is a hydrophobic amino acid [discussed in (9)]. TLR9 has 25 such LRRs in its ectodomain encoded by the N-terminal half of the protein (1-4;9). Crystal structures of TLR1, TLR2 (10) and other LRR-containing proteins revealed that the XLXXLXLXXN sequence folds into a β-strand (9). Each LRR forms a loop such that the juxtaposition of several LRR loops forms a horseshoe structure, with the hydrophobic residues of the LRR consensus sequence pointed inward (9). Some of these LRRs contain insertions of up to 16 amino acids following positions 10 or 15 in the LRR consensus sequence, a common occurrence among LRRs of many TLRs. In TLR3, insertions in two of the LRRs extend outward from the convex face of the protein (11-13) (Figure 2; PDB ID 3CIY). For TLR7, 8 and 9, LRRs 2, 5 and 8 contain long insertions following the tenth residue. These insertions, along with an insertion in LRR11, are positioned proximal to the β-strands formed by the first ten residues. These four insertions may contribute to the ligand-binding site (9). Recent data has shown that TLR9 undergoes proteolytic cleavage at a flexible loop located between LRRs 14 and 15 (14;15).
The CpG1 mutation results in a leucine to proline change at position 499 of the TLR9 protein, which lies in the predicted sixteenth LRR module of the TLR9 ectodomain (Figure 3).
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression/Localization | Northern blot and RT-PCR analysis detects Tlr9 transcript in spleen, lung, liver, lymph node, bone marrow and peripheral blood leukocytes (2-4). Among human peripheral blood mononuclear cells (PBMC), Tlr9 is found at low levels in monocytes, NK cells, T cells, and at higher levels in plasmacytoid dendritic cells (pDCs) and B cells (16). TLR9 is localized in the endoplasmic reticulum (17;18), and at endosomal/lysosomal membranes (18;19).
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Background |
Structurally distinct classes of synthetic CpG ODNs lead to different biological outcomes when applied to a single cell type, suggesting that ligand recognition is one mechanism for regulating the specificity of the CpG-induced immune response [reviewed in (24)]. Studies using the purified recombinant TLR9 extracellular domain fused to the IgG1-Fc domain initially focused on the sequence specificity of recognition. These studies demonstrated direct binding of recombinant TLR9 to CpG ODN; modification of the core CpG motif sequence altered the affinity of TLR9 for binding (25). Recently, the DNA backbone has been shown to be of significant importance for TLR9 activation by CpG ODN (25-27). Experimental stimulation of TLR9 often utilizes phosphorothioate (PS)-ODN, in which one of the backbone oxygens is replaced by sulfur, rendering these ODN more nuclease-resistant than “natural” ODN with a phosphodiester (PD) backbone. It has now been shown that the requirement for the CpG motif and for its specific sequence is dictated by the PS backbone (26;27). Even non-CpG ODNs with a PD backbone can stimulate TLR9 and cytokine production, and there are less stringent sequence requirements for TLR9 activation by such ODNs (26;27). Thus, non-CpG DNAs (such as the host’s own DNA) may activate TLR9 signaling. The compartmentalization of TLR9 in the endosome has been suggested as a major mechanism for preventing vertebrate DNA from initiating immune responses (27;28).
Stimulation by CpG ODNs leads to activation of the MyD88-dependent pathway, ultimately activating cytokine and chemokine gene expression. Upon TLR9 engagement, MyD88, a TIR adaptor protein which mediates signaling downstream of all TLRs except TLR3, is recruited to TLR9, likely to boxes 1 and 2 (see pococurante and lackadaisical) (5) (Figures 4 and 5). Like TLR9 itself, MyD88 has been shown to be recruited to endosomes where retention allows its sustained activation (29). TLR9, like TLR7 and TLR3, additionally depends upon UNC-93B, a 12-spanning intracellular membrane protein, in order to signal (30). Failure of signaling via all of the nucleic acid sensing TLRs, and rather marked immunocompromise, are caused by the 3d mutation, a missense error of UNC-93B. It has been suggested that TLRs 3, 7, 9, and 13 engage in the formation of a macromolecular complex with UNC-93B (31).
Briefly, signal transduction from TLR9 continues as follows [reviewed in (32;33)]: IRAK-4 (see otiose), IRAK-1, IRF5 and TRAF6 are recruited to MyD88 at the receptor, where IRAK-4 phosphorylates IRAK-1. Together, IRAK-1 and TRAF6 then dissociate from the receptor. TRAF6 interaction with TAK1 activates TAK1 to phosphorylate the IkB kinase (IKK) complex (see panr2), which goes on to phosphorylate IkB. Phosphorylated IkB is targeted for ubiquitination and degradation, freeing NF-kB to translocate to the nucleus and activate gene expression. In addition to NF-kB, MAP, ERK 1/2 and JNK kinases are activated, leading to activation of target gene expression (22;34). CpG ODNs also lead to MyD88-dependent activation of IRF7 to regulate gene expression. These genes include those encoding IL-6, IL-1, tumor necrosis factor (TNF), IL-12p40, and type I interferon (IFN), cytokines required for the inflammatory response. Together with ligands on antigen-presenting cells (APCs) that bind to activating receptors on lymphocytes, these cytokines mediate adaptive immune activation.
Together with TLRs 3, 7, and 8, TLR9 detects bacterial and viral nucleic acids. Thus, pDCs from TLR9-deficient mice fail to produce IFN-α in response to MCMV (35), herpes simplex virus 1 (HSV-1) (36;37) and HSV-2 (38). TLR9 contributes to resistance against Trypanosoma cruzi (39), Trypanosoma brucei (40), and Toxoplasma gondii (41), and cooperates with TLR2 to mediate resistance against Mycobacterium tuberculosis (42). The role of TLR9 in mediating resistance to many other microbes continues to be explored.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | The CpG1 mutation substitutes proline for a conserved leucine at position 499 of the TLR9 protein, which lies in the predicted sixteenth LRR module of the TLR9 ectodomain. No tertiary structural data presently exist for TLR9, making it difficult to hypothesize how the CpG1 mutation could affect either ligand binding or receptor dimerization. Recently, the crystal structure of the related TLR3 heterodimer bound to double-strande (ds) RNA has been elucidated (Figure 2). Similar to the TLR2/1 ligand-bound heterodimer (10), the ligand-bound TLR3 heterodimer forms an M-shape. However, unlike Pam3CSK4, dsRNA binds to the concave surfaces of the TLR3 heterodimer at two locations on each ectodomain (13). It has been hypothesized that TLR7, 8 and 9 ligands may also bind to the concave surface of the ectodomain at a site made up by insertions at LRR 2, 5, 8 and 11 (9). The CpG1 mutation might somehow disrupt ligand binding and/or receptor dimerization, or destroy proper folding or localization of the receptor. The CpG1 phenotype supports any and all of these possibilities.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers | Primers cannot be located by automatic search. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | CpG1 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
Primers for PCR amplification
CpG1(F): 5’- AACTCTTCCTGGTTCCAAGGTCTG -3’
CpG1(R): 5’- GGGTATGAATGTCATTGTGTGCC -3’
PCR program
1) 94°C 2:00
2) 94°C 0:15
3) 60°C 0:30
4) 68°C 1:00
5) repeat steps (2-4) 40X
6) 68°C 7:00
7) 4°C ∞
Primers for sequencing
CpG1_seq(F): 5’- CCTTCAACGCTGTCAGAAGCCAC -3’
CpG1_seq(R): same as CpG1(R)
The following sequence of 873 nucleotides (from Genbank genomic region NC_000075 for linear DNA sequence of Tlr9) is amplified:
1812 aactcttcc tggttccaag gtctggtcaa cctctcggtg ctggacctaa
1861 gcgagaactt tctctatgaa agcatcaccc acaccaatgc ctttcagaac ctaacccgcc
1921 tgcgcaagct caacctgtcc ttcaattacc gcaagaaggt atcctttgcc cgcctccacc
1981 tggcaagttc ctttaagaac ctggtgtcac tgcaggagct gaacatgaac ggcatcttct
2041 tccgcttgct caacaagtac acgctcagat ggctggccga tctgcccaaa ctccacactc
2101 tgcatcttca aatgaacttc atcaaccagg cacagctcag catctttggt accttccgag
2161 cccttcgctt tgtggacttg tcagacaatc gcatcagtgg gccttcaacg ctgtcagaag
2221 ccacccctga agaggcagat gatgcagagc aggaggagct gttgtctgcg gatcctcacc
2281 cagctccgct gagcacccct gcttctaaga acttcatgga caggtgtaag aacttcaagt
2341 tcaccatgga cctgtctcgg aacaacctgg tgactatcaa gccagagatg tttgtcaatc
2401 tctcacgcct ccagtgtctt agcctgagcc acaactccat tgcacaggct gtcaatggct
2461 ctcagttcct gccgctgact aatctgcagg tgctggacct gtcccataac aaactggact
2521 tgtaccactg gaaatcgttc agtgagctac cacagttgca ggccctggac ctgagctaca
2581 acagccagcc ctttagcatg aagggtatag gccacaattt cagttttgtg acccatctgt
2641 ccatgctaca gagccttagc ctggcacaca atgacattca taccc
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References |
11. Bell, J. K., Botos, I., Hall, P. R., Askins, J., Shiloach, J., Segal, D. M., and Davies, D. R. (2005) The molecular structure of the Toll-like receptor 3 ligand-binding domain, Proc. Natl. Acad. Sci. U. S. A 102, 10976-10980.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Alyson Mack, Eva Marie Y. Moresco | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Diantha La Vine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Koichi Tabeta, Bruce Beutler |