Phenotypic Mutation 'Cpg1'

• Allele: Cpg1
• Mutation Type: missense
• Chromosome: 9
• Coordinate: 106,225,007 bp (GRCm38)
• Base Change: T ⇒ C (forward strand)
• Gene: Tlr9
• Gene Name: toll-like receptor 9
• Chromosomal Location: 106,222,598-106,226,883 bp (+)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is preferentially expressed in immune cell rich tissues, such as spleen, lymph node, bone marrow and peripheral blood leukocytes. Studies in mice and human indicate that this receptor mediates cellular response to unmethylated CpG dinucleotides in bacterial DNA to mount an innate immune response. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Nullizygous mice exhibit impaired immune responses to CpG DNA and altered susceptibility to EAE and parasitic infection. ENU-induced mutants may exhibit altered susceptibility to viral infection or induced colitis and impaired immune response to unmethylated CpG oligonucleotides. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Leucine changed to Proline
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q9EQU3
• PDB Structure: Crystal structure of mouse TLR9 (unliganded form) [X-RAY DIFFRACTION] ; Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 1) [X-RAY DIFFRACTION] ; Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 2) [X-RAY DIFFRACTION] ; Crystal structure of mouse TLR9 in complex with inhibitory DNA_super [X-RAY DIFFRACTION] ; Crystal Structure of the C-terminal Domain of Mouse TLR9 [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000082207; Gene: ENSMUSG00000045322; AA Change: L499P

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRR	62	85	1.49e2	SMART
LRR	122	144	1.41e1	SMART
LRR	198	221	4.98e-1	SMART
LRR	283	306	6.59e1	SMART
LRR	307	332	1.62e1	SMART
Blast:LRR	333	361	8e-6	BLAST
LRR	390	413	7.38e1	SMART
LRR	414	440	1.86e2	SMART
LRR	496	520	1.81e2	SMART
LRR	521	544	6.05e0	SMART
LRR	545	568	2.27e2	SMART
LRR	575	599	4.58e1	SMART
LRR	628	651	3.87e1	SMART
LRR_TYP	677	700	3.39e-3	SMART
LRR	702	724	2.27e2	SMART
LRR	726	748	3.09e2	SMART
Blast:LRRCT	761	810	4e-11	BLAST
Pfam:TIR	870	1029	7.4e-11	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000062241)
• Meta Mutation Damage Score: 0.8857
• Is this an essential gene?: Probably nonessential (E-score: 0.101)
• Phenotypic Category: Autosomal Semidominant
• Penetrance: 100%
• Mode of Inheritance: Autosomal Semidominant
• Local Stock: Embryos, Sperm, gDNA
• MMRRC Submission: 010464-UCD
• Last Updated: 2021-10-28 11:08 AM by Stephen Lyon
• Record Created: unknown
• Record Posted: 2007-10-18
• Science Writers: Alyson Mack, Eva Marie Y. Moresco
• Illustrators: Diantha La Vine
• Authors: Koichi Tabeta, Bruce Beutler

Accession Number

NCBI RefSeq: NM_031178; MGI: 1932389

Alleles Listed at MGI

All alleles(9) : Targeted, knock-out(1) Gene trapped(1) Chemically induced(7)

Phenotypic Description

The CpG1 phenotype was identified in a G3 screen for mutants with impaired response to Toll-like receptor (TLR) ligands (TLR Signaling Screen). Peritoneal macrophages from CpG1 mice produce normal amounts of tumor necrosis factor (TNF)-α in response to all TLR ligands tested, except oligodeoxynucleotides containing CpG motifs (CpG ODN) (Figure 1A, B) (1). Homozygous CpG1 macrophages produce no TNF-α, and heterozygous macrophages produce an amount intermediate between homozygous mutant and wild type levels. Thus, the CpG1 mutant allele is semidominant or the wild type allele is haploinsufficient. Interestingly, semidominance is only observed at low (<0.1 µM) CpG ODN concentrations; wild type and CpG1 heterozygous cells respond similarly to a higher (1.0 μM) concentration of CpG ODN. Homozygous CpG1 macrophages also fail to produce interleukin (IL)-12p40 in response to CpG ODN (Figure 1C).

 

CpG1 mice are hypersusceptible to mouse cytomegalovirus (MCMV) infection, as demonstrated by a high splenic viral titer (similar to BALB/c mice) four days after intraperitoneal inoculation with 5 x 10⁵ pfu MCMV (MCMV Susceptibility and Resistance Screen). CpG1 mice succumb by six days post-infection, when wild type mice appear healthy. CpG1 mutants also display impaired MCMV-induced cytokine production; specifically, serum levels of interferon (IFN)-α/β, IFN-γ, and IL-12p40 are significantly reduced compared to wild type when tested 36 hours after infection with 5 X 10⁴ pfu. Likely as a consequence, CpG1 mice have a seven-fold reduction in activated splenic natural killer (NK) cells and a six-fold reduction in NKT cells compared to wild type 36 hours post-infection (as measured by intracellular IFN-γ staining) (1).

 

Although not all of the same phenotypes have been examined, those tested are identical between CpG1, CpG2, CpG3 and CpG5 mice. Sequence analysis revealed that all four strains contain mutations in Tlr9. However, the positions of the mutations differ, with the CpG1, CpG3 and CpG5 mutations located in the sixteenth, sixth and ­­fourteenth extracellular leucine-rich repeats (LRR), respectively, and the CpG2 mutation located in the cytoplasmic Toll/IL-1R (TIR) domain. In addition to CpG1, CpG2, CpG3 and CpG5, another strain of mice, designated effete, also exhibits impaired TNF-α responses to CpG ODN treatment. The mutant has no TLR9 mutation; the causative mutation is under investigation.

 

Nature of Mutation

The CpG1 mutation corresponds to a T to C transition at position 1602 of the Tlr9 transcript, in exon 2 of 2 total exons.

 

1587 GTCAATCTCTCACGCCTCCAGTGTCTTAGCCTG
494  -V--N--L--S--R--L--Q--C--L--S--L-

 

The mutated nucleotide is indicated in red lettering, and causes a leucine to proline substitution at residue 499 of the TLR9 protein.

Protein Prediction

TLR9 is a type I integral membrane glycoprotein containing 1032 amino acids. Like the other TLRs, its cytoplasmic domain (at its C terminus) shares similarity with the interleukin-1 and IL-18 receptors (IL-1R and IL-18R) in a conserved region of approximately 200 amino acids known as the Toll/IL-1R (TIR) domain (2-4), which mediates homo- and heterotypic protein interactions during signal transduction. TIR domains in TLRs and in IL receptors contain 3 conserved boxes (boxes 1, 2 and 3), which are required for signaling (5). In addition, TIR domains contain six α-helices (αA, αB, αC, αC’, αD and αE) and five β-strands (βA, βB, βC, βD and βE) which are connected by seven loops (named for the α-helix and β-strand they connect; e.g. AA connects βA with αA). The crystal structures of the TLR1 and TLR2 TIR domains reveal that they fold into a structure with a central five-stranded parallel β-sheet surrounded by five helices (6) (see the record for languid for a picture of the TLR2 TIR domain). Many of the α-helices and connecting loops are predicted to participate in binding partner recognition, and their mutation is expected to abrogate specific binding interactions. This is true of a proline to histidine mutation in the BB loop of TLR4 (see the record for lps3), which has been reported to abolish MyD88 binding to a constitutively active TLR4 mutant (7) and LPS-induced signaling in mice (8).

 

The extracellular domains of TLRs, unlike those of the interleukin receptors, contain multiple leucine-rich repeats (LRRs), which mediate ligand recognition by TLRs and consist of 24-29 amino acids with two conserved leucine-rich sequences: XLXXLXLXXN (residues 1-10, present in all LRR subtypes) followed by XØXXØX₄FXXLX (residues ~11-24, but variable in length, sequence and structure), where X is any amino acid and Ø is a hydrophobic amino acid [discussed in (9)]. TLR9 has 25 such LRRs in its ectodomain encoded by the N-terminal half of the protein (1-4;9). Crystal structures of TLR1, TLR2 (10) and other LRR-containing proteins revealed that the XLXXLXLXXN sequence folds into a β-strand (9). Each LRR forms a loop such that the juxtaposition of several LRR loops forms a horseshoe structure, with the hydrophobic residues of the LRR consensus sequence pointed inward (9). Some of these LRRs contain insertions of up to 16 amino acids following positions 10 or 15 in the LRR consensus sequence, a common occurrence among LRRs of many TLRs. In TLR3, insertions in two of the LRRs extend outward from the convex face of the protein (11-13) (Figure 2; PDB ID 3CIY). For TLR7, 8 and 9, LRRs 2, 5 and 8 contain long insertions following the tenth residue. These insertions, along with an insertion in LRR11, are positioned proximal to the β-strands formed by the first ten residues. These four insertions may contribute to the ligand-binding site  (9). Recent data has shown that TLR9 undergoes proteolytic cleavage at a flexible loop located between LRRs 14 and 15 (14;15).       

 

Figure 3. Protein and domain structure of TLR9. (A) Schematic representation of TLR9 based on crystalized structures of mouse TLR9 LRR (PBD 3WPF) and human TLR2 TIR (1FYW) domains. The residue affected by the CpG1 mutation is highlighted. 3D image was created using UCSF Chimera. (B) TLR9 is a 1032 amino acid protein with an extracellur domain (pink) of leucine rich repeats (LRR), a short transmembrane (TM) domain (blue) and a cytoplasmic Toll/Interleukin-1 receptor (TIR) domain (green). The CpG1 mutation (red asterisk) results in a leucine to proline change at position 499 of the TLR9 protein in the predicted sixteenth LRR. This image is interactive. Click on the image to view other mutations found in TLR9. Click on each mutation for more specific information.

Tlr9 has at least two alternatively spliced transcripts, encoding proteins with variable extensions at their N termini (3;4). It appears that the predominant form lacks any of the N-terminal extensions (4).

 

The CpG1 mutation results in a leucine to proline change at position 499 of the TLR9 protein, which lies in the predicted sixteenth LRR module of the TLR9 ectodomain (Figure 3).

Expression/Localization

Northern blot and RT-PCR analysis detects Tlr9 transcript in spleen, lung, liver, lymph node, bone marrow and peripheral blood leukocytes (2-4). Among human peripheral blood mononuclear cells (PBMC), Tlr9 is found at low levels in monocytes, NK cells, T cells, and at higher levels in plasmacytoid dendritic cells (pDCs) and B cells (16). TLR9 is localized in the endoplasmic reticulum (17;18), and at endosomal/lysosomal membranes (18;19).

Background

Figure 4. Overview of Toll-like receptor (TLR) signaling pathways. Shown are the signaling events downstream of TLR activation that ultimately lead to the induction of thousands of genes including TNF and type I IFN, which are critical in activating innate and adaptive immune responses. TLR1,2,4,5 and 6 are located at the cell surface, while TLR3,7, and 9 are localized in the endosome. Once TLR complexes recognize their ligands, they recruit combinations of adaptor proteins (MyD88, TICAM, TRAM, TIRAP) via homophilic TIR domain interactions.

In the MyD88-dependent pathway utilized by all TLRs except TLR3, MyD88 (lime green) recruits IRAK kinases through their death domains (DD). TRAF6 and IRF5 are also recruited to this complex. Phosphorylation of IRAK1 by IRAK4 allows dissociation of IRAK1 and TRAF6. K63 ubiquitination (small light blue circles) of TRAF6 recruits TAK1 and the TAK1 binding proteins, TAB1 and TAB2. Activation of TAK1 leads to activation of MAP kinase cascades and the IKK complex. NEMO polyubiquitination by TRAF6 is necessary for IKK complex function. The IKK complex phosphorylates IκB, p105, and TPL2 (or MAP3K8), resulting in IκB and p105 ubiquitination and degradation (small pink circles), releasing NF-κB into the nucleus and permitting TPL2 to become activated, respectively. Activation of the p38, JNK and ERK1/2 kinases leads to the activation of both CREB and AP1, which in turn induce many target genes. In pDCs, activation of TLR7 and 9 in endosomes recruits MyD88 and IRAK4, which then interact with TRAF6, TRAF3, IRAK1, IKKα, osteopontin (OPN), and IRF7. IRAK-1 and IKKα phosphorylate and activate IRF7, leading to transcription of interferon-inducible genes and production of large amounts of type I IFN.
 
In the TICAM-dependent pathway stimulated by TLR3 or 4 activation, TICAM (bright yellow) recruits polyubiquitinated RIP1, which interacts with the TRAF6/TAK1 complex and leads to NF-κB activation and proinflammatory cytokine induction. TICAM signaling also leads to type I IFN production through phosphorylation and activation of IRF3 by a complex containing TRAF3, TBK1 and IKKe; RIP1 is not required for TICAM-dependent activation of IRF3.

Note that TLR4 signals through the MyD88-dependent pathway from the cell membrane and is subsequently internalized into late endosomes to signal through the TICAM-dependent pathway. When bound to vesicular stomatitis virus glycoprotein G (VSV-G) (far left), TLR4 can signal through TRAM to induce IRF7 activation, a process that is partially dependent on TICAM. Upon viral stimulation, TLR2 may also be internalized into endosomes to activate both IRF3 and IRF7 by an unknown mechanism. LTA = lipoteichoic acid; LP2 = lipopeptide 2. PAM3CSK4 is a triacyl lipopeptide. Phosphorylation events are represented by small yellow circles labeled with a “P”. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

Toll-like receptors (TLRs) play an essential role in the innate immune response as key sensors of invading microorganisms by recognizing conserved molecular motifs found in many different pathogens, including bacteria, fungi, protozoa and viruses. There are 12 TLRs in mice, and 10 in humans, and each receptor recognizes a distinct microbial ligand. TLR9 is specific for double-stranded DNA unmethylated at CpG motifs (2), which is more abundant in prokaryotic genomes than in eukaryotic genomes (20). CpG ODNs are internalized by immune cells and interact with TLR9 proteins within endosomes (17;18;21). After internalization of DNA, endosome acidification occurs (22), as well as the generation of reactive oxygen species (23). It has been shown that proteolytic cleavage of TLR9 in the endolysosomal compartment is necessary both for efficient binding of ligand to the C-terminal fragment that is produced as well as subsequent signaling events (14;15).

 

Structurally distinct classes of synthetic CpG ODNs lead to different biological outcomes when applied to a single cell type, suggesting that ligand recognition is one mechanism for regulating the specificity of the CpG-induced immune response [reviewed in (24)]. Studies using the purified recombinant TLR9 extracellular domain fused to the IgG1-Fc domain initially focused on the sequence specificity of recognition. These studies demonstrated direct binding of recombinant TLR9 to CpG ODN; modification of the core CpG motif sequence altered the affinity of TLR9 for binding (25). Recently, the DNA backbone has been shown to be of significant importance for TLR9 activation by CpG ODN (25-27). Experimental stimulation of TLR9 often utilizes phosphorothioate (PS)-ODN, in which one of the backbone oxygens is replaced by sulfur, rendering these ODN more nuclease-resistant than “natural” ODN with a phosphodiester (PD) backbone. It has now been shown that the requirement for the CpG motif and for its specific sequence is dictated by the PS backbone (26;27). Even non-CpG ODNs with a PD backbone can stimulate TLR9 and cytokine production, and there are less stringent sequence requirements for TLR9 activation by such ODNs (26;27). Thus, non-CpG DNAs (such as the host’s own DNA) may activate TLR9 signaling. The compartmentalization of TLR9 in the endosome has been suggested as a major mechanism for preventing vertebrate DNA from initiating immune responses (27;28).
 

Stimulation by CpG ODNs leads to activation of the MyD88-dependent pathway, ultimately activating cytokine and chemokine gene expression. Upon TLR9 engagement, MyD88, a TIR adaptor protein which mediates signaling downstream of all TLRs except TLR3, is recruited to TLR9, likely to boxes 1 and 2 (see pococurante and lackadaisical) (5) (Figures 4 and 5). Like TLR9 itself, MyD88 has been shown to be recruited to endosomes where retention allows its sustained activation (29). TLR9, like TLR7 and TLR3, additionally depends upon UNC-93B, a 12-spanning intracellular membrane protein, in order to signal (30). Failure of signaling via all of the nucleic acid sensing TLRs, and rather marked immunocompromise, are caused by the 3d mutation, a missense error of UNC-93B. It has been suggested that TLRs 3, 7, 9, and 13 engage in the formation of a macromolecular complex with UNC-93B (31).

 

Briefly, signal transduction from TLR9 continues as follows [reviewed in (32;33)]: IRAK-4 (see otiose), IRAK-1, IRF5 and TRAF6 are recruited to MyD88 at the receptor, where IRAK-4 phosphorylates IRAK-1. Together, IRAK-1 and TRAF6 then dissociate from the receptor. TRAF6 interaction with TAK1 activates TAK1 to phosphorylate the IkB kinase (IKK) complex (see panr2), which goes on to phosphorylate IkB. Phosphorylated IkB is targeted for ubiquitination and degradation, freeing NF-kB to translocate to the nucleus and activate gene expression. In addition to NF-kB, MAP, ERK 1/2 and JNK kinases are activated, leading to activation of target gene expression (22;34). CpG ODNs also lead to MyD88-dependent activation of IRF7 to regulate gene expression. These genes include those encoding IL-6, IL-1, tumor necrosis factor (TNF), IL-12p40, and type I interferon (IFN), cytokines required for the inflammatory response. Together with ligands on antigen-presenting cells (APCs) that bind to activating receptors on lymphocytes, these cytokines mediate adaptive immune activation.

 

Together with TLRs 3, 7, and 8, TLR9 detects bacterial and viral nucleic acids. Thus, pDCs from TLR9-deficient mice fail to produce IFN-α in response to MCMV (35), herpes simplex virus 1 (HSV-1) (36;37) and HSV-2 (38). TLR9 contributes to resistance against Trypanosoma cruzi (39), Trypanosoma brucei (40), and Toxoplasma gondii (41), and cooperates with TLR2 to mediate resistance against Mycobacterium tuberculosis (42). The role of TLR9 in mediating resistance to many other microbes continues to be explored.

Putative Mechanism

The CpG1 mutation substitutes proline for a conserved leucine at position 499 of the TLR9 protein, which lies in the predicted sixteenth LRR module of the TLR9 ectodomain. No tertiary structural data presently exist for TLR9, making it difficult to hypothesize how the CpG1 mutation could affect either ligand binding or receptor dimerization.  Recently, the crystal structure of the related TLR3 heterodimer bound to double-strande (ds) RNA has been elucidated (Figure 2).  Similar to the TLR2/1 ligand-bound heterodimer (10), the ligand-bound TLR3 heterodimer forms an M-shape.  However, unlike Pam₃CSK₄, dsRNA binds to the concave surfaces of the TLR3 heterodimer at two locations on each ectodomain (13). It has been hypothesized that TLR7, 8 and 9 ligands may also bind to the concave surface of the ectodomain at a site made up by insertions at LRR 2, 5, 8 and 11 (9).  The CpG1 mutation might somehow disrupt ligand binding and/or receptor dimerization, or destroy proper folding or localization of the receptor. The CpG1 phenotype supports any and all of these possibilities.

Primers

Primers cannot be located by automatic search.

Genotyping

CpG1 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

Primers for PCR amplification

CpG1(F): 5’- AACTCTTCCTGGTTCCAAGGTCTG -3’
CpG1(R): 5’- GGGTATGAATGTCATTGTGTGCC -3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:15

3) 60°C             0:30

4) 68°C             1:00

5) repeat steps (2-4) 40X

6) 68°C             7:00

7) 4°C               ∞

 

Primers for sequencing

CpG1_seq(F): 5’- CCTTCAACGCTGTCAGAAGCCAC -3’
CpG1_seq(R): same as CpG1(R)

 

The following sequence of 873 nucleotides (from Genbank genomic region NC_000075 for linear DNA sequence of Tlr9) is amplified:

1812             aactcttcc tggttccaag gtctggtcaa cctctcggtg ctggacctaa
1861 gcgagaactt tctctatgaa agcatcaccc acaccaatgc ctttcagaac ctaacccgcc
1921 tgcgcaagct caacctgtcc ttcaattacc gcaagaaggt atcctttgcc cgcctccacc
1981 tggcaagttc ctttaagaac ctggtgtcac tgcaggagct gaacatgaac ggcatcttct
2041 tccgcttgct caacaagtac acgctcagat ggctggccga tctgcccaaa ctccacactc
2101 tgcatcttca aatgaacttc atcaaccagg cacagctcag catctttggt accttccgag
2161 cccttcgctt tgtggacttg tcagacaatc gcatcagtgg gccttcaacg ctgtcagaag
2221 ccacccctga agaggcagat gatgcagagc aggaggagct gttgtctgcg gatcctcacc
2281 cagctccgct gagcacccct gcttctaaga acttcatgga caggtgtaag aacttcaagt
2341 tcaccatgga cctgtctcgg aacaacctgg tgactatcaa gccagagatg tttgtcaatc
2401 tctcacgcct ccagtgtctt agcctgagcc acaactccat tgcacaggct gtcaatggct
2461 ctcagttcct gccgctgact aatctgcagg tgctggacct gtcccataac aaactggact
2521 tgtaccactg gaaatcgttc agtgagctac cacagttgca ggccctggac ctgagctaca
2581 acagccagcc ctttagcatg aagggtatag gccacaattt cagttttgtg acccatctgt
2641 ccatgctaca gagccttagc ctggcacaca atgacattca taccc

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.

References

   1.  Tabeta, K., Georgel, P., Janssen, E., Du, X., Hoebe, K., Crozat, K., Mudd, S., Shamel, L., Sovath, S., Goode, J., Alexopoulou, L., Flavell, R. A., and Beutler, B. (2004) Toll-like receptors 9 and 3 as essential components of innate immune defense against mouse cytomegalovirus infection, Proc. Natl Acad. Sci. U. S. A 101, 3516-3521.

   2.  Hemmi, H., Takeuchi, O., Kawai, T., Kaisho, T., Sato, S., Sanjo, H., Matsumoto, M., Hoshino, K., Wagner, H., Takeda, K., and Akira, S. (2000) A Toll-like receptor recognizes bacterial DNA, Nature 408, 740-745.

   3.  Du, X., Poltorak, A., Wei, Y., and Beutler, B. (2000) Three novel mammalian toll-like receptors: gene structure, expression, and evolution, Eur. Cytokine Netw. 11, 362-371.

   4.  Chuang, T. H. and Ulevitch, R. J. (2000) Cloning and characterization of a sub-family of human toll-like receptors: hTLR7, hTLR8 and hTLR9, Eur. Cytokine Netw. 11, 372-378.

   5.  Slack, J. L., Schooley, K., Bonnert, T. P., Mitcham, J. L., Qwarnstrom, E. E., Sims, J. E., and Dower, S. K. (2000) Identification of two major sites in the type I interleukin-1 receptor cytoplasmic region responsible for coupling to pro-inflammatory signaling pathways, J. Biol. Chem. 275, 4670-4678.

   6.  Xu, Y., Tao, X., Shen, B., Horng, T., Medzhitov, R., Manley, J. L., and Tong, L. (2000) Structural basis for signal transduction by the Toll/interleukin-1 receptor domains, Nature 408, 111-115.

   7.  Rhee, S. H. and Hwang, D. (2000) Murine TOLL-like Receptor 4 Confers Lipopolysaccharide Responsiveness as Determined by Activation of NFkappa B and Expression of the Inducible Cyclooxygenase, J. Biol. Chem. 275, 34035-34040.

   8.  Poltorak, A., He, X., Smirnova, I., Liu, M.-Y., Van Huffel, C., Du, X., Birdwell, D., Alejos, E., Silva, M., Galanos, C., Freudenberg, M. A., Ricciardi-Castagnoli, P., Layton, B., and Beutler, B. (1998) Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene, Science 282, 2085-2088.

   9.  Bell, J. K., Mullen, G. E., Leifer, C. A., Mazzoni, A., Davies, D. R., and Segal, D. M. (2003) Leucine-rich repeats and pathogen recognition in Toll-like receptors, Trends Immunol. 24, 528-533.

 10.  Jin, M. S., Kim, S. E., Heo, J. Y., Lee, M. E., Kim, H. M., Paik, S. G., Lee, H., and Lee, J. O. (2007) Crystal Structure of the TLR1-TLR2 Heterodimer Induced by Binding of a Tri-Acylated Lipopeptide, Cell 130, 1071-1082.

 11.  Bell, J. K., Botos, I., Hall, P. R., Askins, J., Shiloach, J., Segal, D. M., and Davies, D. R. (2005) The molecular structure of the Toll-like receptor 3 ligand-binding domain, Proc. Natl. Acad. Sci. U. S. A 102, 10976-10980.

 12.  Choe, J., Kelker, M. S., and Wilson, I. A. (2005) Crystal Structure of Human Toll-Like Receptor 3 (TLR3) Ectodomain, Science 309, 581-585.

 13.  Liu, L., Botos, I., Wang, Y., Leonard, J. N., Shiloach, J., Segal, D. M., and Davies, D. R. (2008) Structural basis of toll-like receptor 3 signaling with double-stranded RNA, Science 320, 379-381.

 14.  Park, B., Brinkmann, M. M., Spooner, E., Lee, C. C., Kim, Y. M., and Ploegh, H. L. (2008) Proteolytic cleavage in an endolysosomal compartment is required for activation of Toll-like receptor 9, Nat. Immunol. 9, 1407-1414.

 15.  Ewald, S. E., Lee, B. L., Lau, L., Wickliffe, K. E., Shi, G. P., Chapman, H. A., and Barton, G. M. (2008) The ectodomain of Toll-like receptor 9 is cleaved to generate a functional receptor, Nature 456, 658-662.

 16.  Hornung, V., Rothenfusser, S., Britsch, S., Krug, A., Jahrsdorfer, B., Giese, T., Endres, S., and Hartmann, G. (2002) Quantitative expression of toll-like receptor 1-10 mRNA in cellular subsets of human peripheral blood mononuclear cells and sensitivity to CpG oligodeoxynucleotides, J. Immunol. 168, 4531-4537.

 17.  Latz, E., Schoenemeyer, A., Visintin, A., Fitzgerald, K. A., Monks, B. G., Knetter, C. F., Lien, E., Nilsen, N. J., Espevik, T., and Golenbock, D. T. (2004) TLR9 signals after translocating from the ER to CpG DNA in the lysosome, Nat. Immunol. 5, 190-198.

 18.  Leifer, C. A., Kennedy, M. N., Mazzoni, A., Lee, C., Kruhlak, M. J., and Segal, D. M. (2004) TLR9 is localized in the endoplasmic reticulum prior to stimulation, J. Immunol. 173, 1179-1183.

 19.  Ahmad-Nejad, P., Hacker, H., Rutz, M., Bauer, S., Vabulas, R. M., and Wagner, H. (2002) Bacterial CpG-DNA and lipopolysaccharides activate Toll-like receptors at distinct cellular compartments, Eur. J. Immunol. 32, 1958-1968.

 20.  Cardon, L. R., Burge, C., Clayton, D. A., and Karlin, S. (1994) Pervasive CpG suppression in animal mitochondrial genomes, Proc. Natl. Acad. Sci. U. S. A 91, 3799-3803.

 21.  Ishii, K. J., Takeshita, F., Gursel, I., Gursel, M., Conover, J., Nussenzweig, A., and Klinman, D. M. (2002) Potential role of phosphatidylinositol 3 kinase, rather than DNA-dependent protein kinase, in CpG DNA-induced immune activation, J. Exp. Med. 196, 269-274.

 22.  Hacker, H., Mischak, H., Miethke, T., Liptay, S., Schmid, R., Sparwasser, T., Heeg, K., Lipford, G. B., and Wagner, H. (1998) CpG-DNA-specific activation of antigen-presenting cells requires stress kinase activity and is preceded by non-specific endocytosis and endosomal maturation, EMBO J. 17, 6230-6240.

 23.  Yi, A. K., Tuetken, R., Redford, T., Waldschmidt, M., Kirsch, J., and Krieg, A. M. (1998) CpG motifs in bacterial DNA activate leukocytes through the pH-dependent generation of reactive oxygen species, J. Immunol. 160, 4755-4761.

 24.  Klinman, D. M. (2004) Immunotherapeutic uses of CpG oligodeoxynucleotides, Nat. Rev. Immunol. 4, 249-258.

 25.  Rutz, M., Metzger, J., Gellert, T., Luppa, P., Lipford, G. B., Wagner, H., and Bauer, S. (2004) Toll-like receptor 9 binds single-stranded CpG-DNA in a sequence- and pH-dependent manner, Eur. J. Immunol. 34, 2541-2550.

 26.  Roberts, T. L., Sweet, M. J., Hume, D. A., and Stacey, K. J. (2005) Cutting edge: species-specific TLR9-mediated recognition of CpG and non-CpG phosphorothioate-modified oligonucleotides, J Immunol. 174, 605-608.

 27.  Yasuda, K., Rutz, M., Schlatter, B., Metzger, J., Luppa, P. B., Schmitz, F., Haas, T., Heit, A., Bauer, S., and Wagner, H. (2006) CpG motif-independent activation of TLR9 upon endosomal translocation of "natural" phosphodiester DNA, Eur. J Immunol. 36, 431-436.

 28.  Yasuda, K., Yu, P., Kirschning, C. J., Schlatter, B., Schmitz, F., Heit, A., Bauer, S., Hochrein, H., and Wagner, H. (2005) Endosomal translocation of vertebrate DNA activates dendritic cells via TLR9-dependent and -independent pathways, J Immunol. 174, 6129-6136.

 29.  Honda, K., Ohba, Y., Yanai, H., Negishi, H., Mizutani, T., Takaoka, A., Taya, C., and Taniguchi, T. (2005) Spatiotemporal regulation of MyD88-IRF-7 signalling for robust type-I interferon induction, Nature 434, 1035-1040.

 30.  Tabeta, K., Hoebe, K., Janssen, E. M., Du, X., Georgel, P., Crozat, K., Mudd, S., Mann, N., Sovath, S., Goode, J., Shamel, L., Herskovits, A. A., Portnoy, D. A., Cooke, M., Tarantino, L. M., Wiltshire, T., Steinberg, B. E., Grinstein, S., and Beutler, B. (2006) The Unc93b1 mutation 3d disrupts exogenous antigen presentation and signaling via Toll-like receptors 3, 7 and 9, Nat. Immunol. 7, 156-164.

 31. Brinkmann, M. M., Spooner, E., Hoebe, K., Beutler, B., Ploegh, H. L., and Kim, Y. M. (2007) The interaction between the ER membrane protein UNC93B and TLR3, 7, and 9 is crucial for TLR signaling, J. Cell Biol. 177, 265-275.

 32.  Baccala, R., Hoebe, K., Kono, D. H., Beutler, B., and Theofilopoulos, A. N. (2007) TLR-dependent and TLR-independent pathways of type I interferon induction in systemic autoimmunity, Nat. Med. 13, 543-551.

 33.  Kawai, T. and Akira, S. (2006) Innate immune recognition of viral infection, Nat. Immunol. 7, 131-137.

 34.  Ninomiya-Tsuji, J., Kishimoto, K., Hiyama, A., Inoue, J., Cao, Z., and Matsumoto, K. (1999) The kinase TAK1 can activate the NIK-I kappaB as well as the MAP kinase cascade in the IL-1 signalling pathway, Nature 398, 252-256.

 35.  Krug, A., French, A. R., Barchet, W., Fischer, J. A., Dzionek, A., Pingel, J. T., Orihuela, M. M., Akira, S., Yokoyama, W. M., and Colonna, M. (2004) TLR9-dependent recognition of MCMV by IPC and DC generates coordinated cytokine responses that activate antiviral NK cell function, Immunity 21, 107-119.

 36.  Krug, A., Luker, G. D., Barchet, W., Leib, D. A., Akira, S., and Colonna, M. (2004) Herpes simplex virus type 1 activates murine natural interferon-producing cells through toll-like receptor 9, Blood 103, 1433-1437.

 37.  Hochrein, H., Schlatter, B., O'Keeffe, M., Wagner, C., Schmitz, F., Schiemann, M., Bauer, S., Suter, M., and Wagner, H. (2004) Herpes simplex virus type-1 induces IFN-alpha production via Toll-like receptor 9-dependent and -independent pathways, Proc. Natl. Acad. Sci. U. S. A 101, 11416-11421.

 38.  Lund, J., Sato, A., Akira, S., Medzhitov, R., and Iwasaki, A. (2003) Toll-like Receptor 9-mediated Recognition of Herpes Simplex Virus-2 by Plasmacytoid Dendritic Cells, J. Exp. Med. 198, 513-520.

 39.  Bafica, A., Santiago, H. C., Goldszmid, R., Ropert, C., Gazzinelli, R. T., and Sher, A. (2006) Cutting edge: TLR9 and TLR2 signaling together account for MyD88-dependent control of parasitemia in Trypanosoma cruzi infection, J Immunol. 177, 3515-3519.

 40.  Drennan, M. B., Stijlemans, B., Van den, A. J., Quesniaux, V. J., Barkhuizen, M., Brombacher, F., De, B. P., Ryffel, B., and Magez, S. (2005) The induction of a type 1 immune response following a Trypanosoma brucei infection is MyD88 dependent, J Immunol. 175, 2501-2509.

 41.  Minns, L. A., Menard, L. C., Foureau, D. M., Darche, S., Ronet, C., Mielcarz, D. W., Buzoni-Gatel, D., and Kasper, L. H. (2006) TLR9 is required for the gut-associated lymphoid tissue response following oral infection of Toxoplasma gondii, J Immunol. 176, 7589-7597.

 42.  Bafica, A., Scanga, C. A., Feng, C. G., Leifer, C., Cheever, A., and Sher, A. (2005) TLR9 regulates Th1 responses and cooperates with TLR2 in mediating optimal resistance to Mycobacterium tuberculosis, J Exp. Med. 202, 1715-1724.