Incidental Mutation 'S24628:Thbs2'
ID385672
Institutional Source Beutler Lab
Gene Symbol Thbs2
Ensembl Gene ENSMUSG00000023885
Gene Namethrombospondin 2
SynonymsThbs-2, Thrombospondin-2, TSP2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #S24628 () of strain waterfowl
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location14665500-14694235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 14679973 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 573 (S573A)
Ref Sequence ENSEMBL: ENSMUSP00000128308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170872]
Predicted Effect probably benign
Transcript: ENSMUST00000170872
AA Change: S573A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128308
Gene: ENSMUSG00000023885
AA Change: S573A

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
TSPN 21 215 3.8e-60 SMART
VWC 320 374 3.55e-19 SMART
TSP1 384 431 3.36e-11 SMART
TSP1 440 492 1.35e-15 SMART
TSP1 497 549 8.6e-18 SMART
EGF 552 589 6.3e-3 SMART
EGF 593 647 1.56e1 SMART
EGF 651 692 2.19e-2 SMART
Pfam:TSP_3 729 764 2.5e-12 PFAM
Pfam:TSP_3 763 787 7.4e-7 PFAM
Pfam:TSP_3 788 823 9.4e-12 PFAM
Pfam:TSP_3 823 846 4.1e-7 PFAM
Pfam:TSP_3 847 884 1.7e-12 PFAM
Pfam:TSP_3 885 920 1.3e-11 PFAM
Pfam:TSP_3 921 956 3.1e-11 PFAM
Pfam:TSP_C 974 1171 1e-98 PFAM
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 88.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin family. It is a disulfide-linked homotrimeric glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein has been shown to function as a potent inhibitor of tumor growth and angiogenesis. Studies of the mouse counterpart suggest that this protein may modulate the cell surface properties of mesenchymal cells and be involved in cell adhesion and migration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display premature death, abnormal tails, marked structural and functional abnormalities in a variety of connective tissues including skin, tendon, bone, and blood vessels, accelerated wound healing, and enhanced susceptibility to experimental skin tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 55,852,288 V658I probably benign Het
Ccdc40 T C 11: 119,232,118 Y249H possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Homo
Gbp4 G A 5: 105,121,106 R394C possibly damaging Het
Gpr183 C A 14: 121,954,476 C211F probably damaging Homo
Lcp1 A T 14: 75,227,006 I556F possibly damaging Het
Letm1 G A 5: 33,747,444 P513S probably benign Het
Letm1 G A 5: 33,747,446 P512L probably benign Het
Msh3 A G 13: 92,346,786 V283A possibly damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Npr3 C A 15: 11,848,563 M439I probably benign Het
Olfr1023 A T 2: 85,887,438 I213F possibly damaging Het
Olfr1034 A T 2: 86,047,055 H191L probably benign Het
Pax5 G A 4: 44,691,886 A120V probably damaging Het
Plcb1 A G 2: 135,337,499 Y609C probably damaging Het
Plxna1 G A 6: 89,357,336 H104Y probably benign Homo
Rnf213 A T 11: 119,414,469 I509F probably damaging Het
Ryr2 T C 13: 11,869,156 S213G probably damaging Homo
Spint1 A G 2: 119,245,615 T231A probably damaging Het
Tbcel C A 9: 42,444,500 C139F probably benign Het
Tmem43 C A 6: 91,482,318 P257Q probably benign Homo
Tmprss13 A G 9: 45,337,132 probably null Het
Tnc C T 4: 64,018,012 G229D probably damaging Homo
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn1r196 T A 13: 22,293,836 V215D probably damaging Homo
Vmn1r22 G T 6: 57,900,332 T220K probably benign Homo
Vmn2r116 G A 17: 23,387,279 M388I possibly damaging Het
Zap70 A G 1: 36,770,811 M1V probably null Homo
Zfp282 A G 6: 47,897,881 D340G probably damaging Homo
Zfp282 T A 6: 47,905,053 I558N possibly damaging Homo
Other mutations in Thbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Thbs2 APN 17 14668835 missense probably damaging 1.00
IGL00764:Thbs2 APN 17 14690252 missense probably damaging 0.98
IGL01370:Thbs2 APN 17 14690065 missense possibly damaging 0.82
IGL01604:Thbs2 APN 17 14678769 missense probably benign 0.31
IGL01936:Thbs2 APN 17 14687814 missense probably benign 0.00
IGL02061:Thbs2 APN 17 14679914 missense probably benign 0.35
IGL02255:Thbs2 APN 17 14689785 missense probably benign 0.00
IGL02342:Thbs2 APN 17 14676316 missense probably damaging 1.00
IGL02402:Thbs2 APN 17 14671454 missense probably benign 0.01
IGL02499:Thbs2 APN 17 14684066 splice site probably benign
IGL02572:Thbs2 APN 17 14677013 missense possibly damaging 0.72
IGL02701:Thbs2 APN 17 14683361 missense probably benign 0.05
IGL02871:Thbs2 APN 17 14685786 missense probably benign
IGL03058:Thbs2 APN 17 14689969 missense possibly damaging 0.91
IGL03185:Thbs2 APN 17 14681410 nonsense probably null
IGL03232:Thbs2 APN 17 14691413 start codon destroyed probably null
IGL03289:Thbs2 APN 17 14690122 missense probably benign 0.00
IGL03407:Thbs2 APN 17 14673273 missense probably benign 0.00
H8562:Thbs2 UTSW 17 14671453 missense probably benign 0.00
IGL02802:Thbs2 UTSW 17 14684127 missense probably benign 0.01
R0088:Thbs2 UTSW 17 14681701 missense possibly damaging 0.96
R0167:Thbs2 UTSW 17 14667525 splice site probably benign
R0415:Thbs2 UTSW 17 14679973 missense probably benign
R0658:Thbs2 UTSW 17 14680325 missense probably benign 0.00
R0735:Thbs2 UTSW 17 14679815 missense probably benign 0.00
R1582:Thbs2 UTSW 17 14671288 missense probably damaging 1.00
R1585:Thbs2 UTSW 17 14689768 missense probably benign 0.00
R1608:Thbs2 UTSW 17 14685781 missense probably benign
R1721:Thbs2 UTSW 17 14678810 missense probably benign 0.00
R1724:Thbs2 UTSW 17 14685900 missense possibly damaging 0.80
R1791:Thbs2 UTSW 17 14685813 missense probably benign
R1816:Thbs2 UTSW 17 14670713 missense probably benign 0.01
R1816:Thbs2 UTSW 17 14670714 missense probably benign 0.00
R1911:Thbs2 UTSW 17 14689842 missense probably benign 0.38
R2137:Thbs2 UTSW 17 14673306 missense probably damaging 1.00
R2152:Thbs2 UTSW 17 14673209 missense probably damaging 1.00
R2244:Thbs2 UTSW 17 14671413 missense probably damaging 1.00
R2325:Thbs2 UTSW 17 14690289 splice site probably null
R2509:Thbs2 UTSW 17 14685843 missense probably benign 0.11
R3838:Thbs2 UTSW 17 14687851 missense probably benign
R4173:Thbs2 UTSW 17 14681631 intron probably null
R4427:Thbs2 UTSW 17 14680335 missense probably benign
R4495:Thbs2 UTSW 17 14671413 missense probably damaging 1.00
R4789:Thbs2 UTSW 17 14671488 missense probably damaging 1.00
R4928:Thbs2 UTSW 17 14678900 missense probably damaging 1.00
R5058:Thbs2 UTSW 17 14676329 missense probably damaging 1.00
R5112:Thbs2 UTSW 17 14670590 splice site probably null
R5619:Thbs2 UTSW 17 14681244 missense probably damaging 1.00
R5649:Thbs2 UTSW 17 14689953 missense probably damaging 1.00
R5664:Thbs2 UTSW 17 14689837 missense probably damaging 1.00
R5801:Thbs2 UTSW 17 14687863 missense probably damaging 1.00
R5816:Thbs2 UTSW 17 14684071 critical splice donor site probably null
R5840:Thbs2 UTSW 17 14681430 splice site probably null
R6149:Thbs2 UTSW 17 14679680 critical splice donor site probably null
R6166:Thbs2 UTSW 17 14680388 missense probably damaging 1.00
R6412:Thbs2 UTSW 17 14677077 missense probably damaging 1.00
R6473:Thbs2 UTSW 17 14685796 missense probably benign 0.23
R6640:Thbs2 UTSW 17 14673368 missense possibly damaging 0.94
R6695:Thbs2 UTSW 17 14674164 missense possibly damaging 0.54
R6711:Thbs2 UTSW 17 14690265 missense probably benign 0.00
R6947:Thbs2 UTSW 17 14689767 missense possibly damaging 0.79
R6962:Thbs2 UTSW 17 14681820 missense probably benign 0.00
X0025:Thbs2 UTSW 17 14681800 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGTTGAGAAGCAAATATCTGTGACC -3'
(R):5'- AGCTGTTCCATGGGTGACAG -3'

Sequencing Primer
(F):5'- CAGAGGTACCAACCTCAT -3'
(R):5'- TGACAGGGCATGCATACTTG -3'
Posted On2016-05-10