Incidental Mutation 'R5614:Myl9'
ID490463
Institutional Source Beutler Lab
Gene Symbol Myl9
Ensembl Gene ENSMUSG00000067818
Gene Namemyosin, light polypeptide 9, regulatory
SynonymsMylc2c, RLC-C, MLC20
MMRRC Submission 043275-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.406) question?
Stock #R5614 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location156775420-156781658 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) G to A at 156781163 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000085913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088552]
Predicted Effect probably benign
Transcript: ENSMUST00000088552
SMART Domains Protein: ENSMUSP00000085913
Gene: ENSMUSG00000067818

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
EFh 33 61 1.26e-7 SMART
EFh 102 130 1.15e0 SMART
Blast:EFh 138 166 4e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145299
Meta Mutation Damage Score 0.0608 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin, a structural component of muscle, consists of two heavy chains and four light chains. The protein encoded by this gene is a myosin light chain that may regulate muscle contraction by modulating the ATPase activity of myosin heads. The encoded protein binds calcium and is activated by myosin light chain kinase. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G A 5: 24,550,142 A330V probably benign Het
Abca1 A G 4: 53,046,132 V1712A probably damaging Het
Ankmy2 T C 12: 36,193,784 S333P probably damaging Het
Arfrp1 A G 2: 181,359,443 probably benign Het
Atp13a2 A G 4: 140,992,182 T21A probably benign Het
Bud23 C A 5: 135,059,112 A152S probably benign Het
Cant1 T C 11: 118,408,743 D260G probably benign Het
Ces1b T C 8: 93,068,208 I254M probably benign Het
Ces1d T C 8: 93,176,204 T375A probably benign Het
Cfap54 A G 10: 93,045,049 L384P probably damaging Het
Chrne C T 11: 70,615,053 V469I possibly damaging Het
Clspn A G 4: 126,580,962 E968G probably damaging Het
Col5a3 A G 9: 20,783,476 probably benign Het
Dtx4 T C 19: 12,482,183 Y419C probably damaging Het
Fam171b T A 2: 83,812,873 I42N probably damaging Het
Fam43a T C 16: 30,601,672 I358T possibly damaging Het
Fasn T C 11: 120,813,328 S1422G probably benign Het
Fig4 A T 10: 41,272,985 V157E probably damaging Het
Fus T C 7: 127,974,371 probably benign Het
Hmcn2 G T 2: 31,428,303 V3887F probably damaging Het
Hmgcll1 A G 9: 76,081,393 Y182C probably damaging Het
Hook2 T A 8: 85,002,508 I585N probably damaging Het
Iars2 T C 1: 185,289,508 T866A probably benign Het
Lrit1 T A 14: 37,061,954 M413K probably benign Het
Nelfa A T 5: 33,920,500 L179Q probably damaging Het
Nod2 A T 8: 88,664,196 D355V probably damaging Het
Npbwr1 A T 1: 5,916,811 S161R probably damaging Het
Nxpe2 A T 9: 48,323,101 F289I probably benign Het
Odf2 A G 2: 29,920,867 I538M probably damaging Het
Osbpl6 T A 2: 76,568,109 V379E probably damaging Het
Pkhd1 A G 1: 20,073,526 C3859R possibly damaging Het
Rgs1 G T 1: 144,246,257 T99N probably benign Het
Rnf6 T C 5: 146,218,100 probably null Het
Rtp1 C A 16: 23,431,190 Q102K possibly damaging Het
Sec24c T A 14: 20,682,738 V123E possibly damaging Het
Serpini2 T C 3: 75,257,707 probably benign Het
Stxbp5 A T 10: 9,760,894 probably benign Het
Tecta A G 9: 42,339,055 S1809P probably damaging Het
Tgfb2 T A 1: 186,625,513 I394F probably benign Het
Thg1l T C 11: 45,950,227 Y175C possibly damaging Het
Tmem67 C A 4: 12,061,755 K572N possibly damaging Het
Tollip T C 7: 141,892,088 T19A probably damaging Het
Ttn A G 2: 76,712,107 Y25185H probably damaging Het
Vgll2 A T 10: 52,025,222 R83* probably null Het
Wfdc8 G T 2: 164,603,203 A164E probably damaging Het
Ylpm1 T C 12: 85,064,944 probably benign Het
Zfp326 T A 5: 105,888,495 S91T probably damaging Het
Zfp638 T C 6: 83,929,641 F263L probably damaging Het
Zfp800 G A 6: 28,243,136 T610I probably damaging Het
Zmym4 A G 4: 126,910,936 F475L possibly damaging Het
Other mutations in Myl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02010:Myl9 APN 2 156778659 missense probably damaging 0.99
IGL02536:Myl9 APN 2 156778549 missense probably damaging 1.00
R2679:Myl9 UTSW 2 156780506 missense probably damaging 1.00
X0010:Myl9 UTSW 2 156780578 missense probably damaging 1.00
X0021:Myl9 UTSW 2 156781098 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGCCTGCAGTCATTAACCCAG -3'
(R):5'- TAGGGTCAGAGATCCCTTCTAG -3'

Sequencing Primer
(F):5'- GCAGTCATTAACCCAGTCGTG -3'
(R):5'- GTCAGAGATCCCTTCTAGTTAGTGC -3'
Posted On2017-10-11