Incidental Mutation 'R1188:Stt3a'
ID102361
Institutional Source Beutler Lab
Gene Symbol Stt3a
Ensembl Gene ENSMUSG00000032116
Gene NameSTT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae)
SynonymsItm1
MMRRC Submission 039260-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R1188 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location36729344-36767679 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36751340 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 59 (S59P)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120381] [ENSMUST00000128270] [ENSMUST00000217599]
Predicted Effect probably damaging
Transcript: ENSMUST00000120381
AA Change: S208P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113116
Gene: ENSMUSG00000032116
AA Change: S208P

DomainStartEndE-ValueType
Pfam:STT3 17 484 2e-163 PFAM
Pfam:PMT_2 97 257 9.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128270
Predicted Effect probably damaging
Transcript: ENSMUST00000135934
AA Change: S59P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117794
Gene: ENSMUSG00000032116
AA Change: S59P

DomainStartEndE-ValueType
Pfam:STT3 1 112 1.8e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215998
Predicted Effect probably benign
Transcript: ENSMUST00000217599
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a catalytic subunit of the N-oligosaccharyltransferase (OST) complex, which functions in the endoplasmic reticulum to transfer glycan chains to asparagine residues of target proteins. A separate complex containing a similar catalytic subunit with an overlapping function also exists. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik T C 5: 65,990,398 Y14C unknown Het
Afap1l2 T C 19: 56,925,069 K312E probably damaging Het
Amigo2 T A 15: 97,245,713 E276V probably benign Het
Asna1 A G 8: 85,019,793 I142T probably damaging Het
Atf2 A G 2: 73,845,537 F114L probably damaging Het
Avpr1a G T 10: 122,448,919 G39C possibly damaging Het
Ccpg1 A G 9: 73,012,506 R468G possibly damaging Het
Celf6 G T 9: 59,590,678 R130L probably benign Het
Dsp T C 13: 38,194,963 S1296P probably damaging Het
Fnip2 C T 3: 79,462,162 R1072H probably damaging Het
Fsip2 G T 2: 82,975,017 C560F possibly damaging Het
Gpr20 A C 15: 73,695,768 H257Q probably damaging Het
Gys2 T A 6: 142,455,183 H297L probably damaging Het
Habp2 G A 19: 56,311,722 S201N probably benign Het
Hars2 T C 18: 36,787,969 I198T probably damaging Het
Jag2 G A 12: 112,920,121 Q247* probably null Het
Jam2 A G 16: 84,806,867 T81A probably damaging Het
Mrps26 G A 2: 130,564,381 E145K probably damaging Het
Nup210l T C 3: 90,198,179 F1545L probably benign Het
Olfr961 A G 9: 39,647,476 Y250C probably damaging Het
Pikfyve T A 1: 65,246,959 V1074D possibly damaging Het
Prkag1 T A 15: 98,814,598 I118F probably damaging Het
R3hdm2 G A 10: 127,452,755 V91I probably benign Het
Rnf168 T C 16: 32,298,659 V346A probably benign Het
Slc17a7 T C 7: 45,169,887 V129A possibly damaging Het
Snai3 T A 8: 122,454,962 Q252L probably damaging Het
Snx17 T C 5: 31,195,822 V133A probably benign Het
Sun1 C T 5: 139,238,856 R546C probably damaging Het
Thsd4 T A 9: 60,394,406 Q202L probably benign Het
Tnrc6b A G 15: 80,879,229 T311A probably benign Het
Tshr T A 12: 91,502,168 D18E probably benign Het
Ttn A T 2: 76,789,429 L15965Q probably damaging Het
Wnk1 C A 6: 119,948,709 E1265* probably null Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Other mutations in Stt3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01866:Stt3a APN 9 36734366 missense probably benign 0.00
IGL02237:Stt3a APN 9 36749637 nonsense probably null
IGL02644:Stt3a APN 9 36752353 missense possibly damaging 0.70
IGL02710:Stt3a APN 9 36758745 missense probably damaging 0.99
IGL03085:Stt3a APN 9 36732970 intron probably benign
IGL03180:Stt3a APN 9 36759256 missense probably damaging 1.00
IGL03295:Stt3a APN 9 36763331 splice site probably null
Scramble UTSW 9 36735466 missense probably damaging 1.00
Western UTSW 9 36735386 missense probably damaging 1.00
R0314:Stt3a UTSW 9 36749545 intron probably benign
R0731:Stt3a UTSW 9 36735512 missense probably damaging 1.00
R1797:Stt3a UTSW 9 36743415 critical splice donor site probably null
R1846:Stt3a UTSW 9 36763385 missense probably damaging 1.00
R2152:Stt3a UTSW 9 36747996 missense probably damaging 1.00
R2220:Stt3a UTSW 9 36749551 critical splice donor site probably null
R2317:Stt3a UTSW 9 36748075 missense probably benign 0.08
R3689:Stt3a UTSW 9 36759322 missense probably damaging 1.00
R4299:Stt3a UTSW 9 36763344 missense probably damaging 1.00
R4586:Stt3a UTSW 9 36741793 missense probably damaging 1.00
R4595:Stt3a UTSW 9 36735512 missense probably damaging 1.00
R4689:Stt3a UTSW 9 36732929 missense possibly damaging 0.91
R4736:Stt3a UTSW 9 36749712 missense probably benign 0.01
R5145:Stt3a UTSW 9 36735466 missense probably damaging 1.00
R5208:Stt3a UTSW 9 36746595 missense possibly damaging 0.78
R5665:Stt3a UTSW 9 36759314 missense probably damaging 1.00
R5748:Stt3a UTSW 9 36752400 missense probably benign 0.21
R6341:Stt3a UTSW 9 36751296 missense probably damaging 1.00
R6853:Stt3a UTSW 9 36741727 missense possibly damaging 0.89
R6859:Stt3a UTSW 9 36735386 missense probably damaging 1.00
R7453:Stt3a UTSW 9 36747970 missense possibly damaging 0.91
R7495:Stt3a UTSW 9 36747939 missense probably benign 0.03
R7745:Stt3a UTSW 9 36751239 nonsense probably null
R8007:Stt3a UTSW 9 36741769 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAACCAACAAAGGAAATCTGCATAGAAAGAA -3'
(R):5'- TCACTGTTACATCTCCAGCTTGTCTACAT -3'

Sequencing Primer
(F):5'- TCTGCATAGAAAGAATGGTGCCC -3'
(R):5'- CACTGTAGCTTGGTATATACAGTTG -3'
Genotyping

NOTE: These primers have not been validated.

 

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

R11880022_PCR_F: 5’- GAAACCAACAAAGGAAATCTGCATAGAAAGAA-3’

R11880022_PCR_R: 5’- TCACTGTTACATCTCCAGCTTGTCTACAT-3’

 

Sequencing Primers

R11880022_SEQ_F: 5’- TCTGCATAGAAAGAATGGTGCCC-3’
 

R11880022_SEQ_R: 5’- CACTGTAGCTTGGTATATACAGTTG-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 1041 nucleotides is amplified (NCBI RefSeq: NC_000075, chromosome 9):

 

gaaaccaaca aaggaaatct gcatagaaag aatggtgccc aggcagtaaa cagtacagta       

ggctacgtag atccggtgag aaaaacggcc tgtcagcatt agcaccagga catgtagagg      

aatcaagttg atcaggaaca catagcctcc ccatgaagag acctgtgagg atagaacagt      

ccctttgagc accactcaca acatgttcaa ctgtatatac caagctacag tgtaaatata      

ggcgaaacta attatgtcac acacaaaatc taaggagaag cagagatata aagaaagtca      

agagacagat gtaaaattat acaaaatatg tattaggaaa gagaaatttt aaggaaaata      

taacaaaaat atgagaaaac caacatatac ccataggaag tacagtaata cagaatttga      

aaatttttat tagcagacta aaaaaaaaaa aaacagaggg ctaagatgta gctaggttag      

tagagagctt gccaagcata gattatggta cacatctgca atcccagctc tcaagaagta      

gaggcaggag gatcaggtca tcctcagcag aggagagaac aaccaaggat acataagacc      

ccatatcaaa gagaactagg tgaaaaaaga aaattttaaa attgaaaata tggggctgga      

gagatggctc agtgattaag agtactgact gctcttccaa aggtactgag ttcaattccc      

agcaaccaca tggtgggtca caaccatctg caatgtgatc tgacaccctc ttctggtatg      

tatgaagaca gctacaaagg tactcatcat atgtatcaaa taaataaatc tttaaaaaaa      

aaagaaaaac ttagccggac agtagtgggc catgccttta atcccagcac ttgggaggca      

gaggcaggtg gatttctgag tttgaggcca gcctggtcta cagagtgagt tccaggatag      

ccagggctac acagagaaac cccgtcttga acacccccca aaaaattaaa atatgtagac     

aagctggaga tgtaacagtg a

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. + strand, A>G).

Posted On2014-01-15