Incidental Mutation 'R1241:Crisp4'
ID151970
Institutional Source Beutler Lab
Gene Symbol Crisp4
Ensembl Gene ENSMUSG00000025774
Gene Namecysteine-rich secretory protein 4
Synonyms
MMRRC Submission 039308-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1241 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location18115191-18145902 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18122794 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 233 (Y233C)
Ref Sequence ENSEMBL: ENSMUSP00000111001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026876] [ENSMUST00000115340] [ENSMUST00000115344]
Predicted Effect probably damaging
Transcript: ENSMUST00000026876
AA Change: Y194C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026876
Gene: ENSMUSG00000025774
AA Change: Y194C

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
SCP 44 188 1.32e-45 SMART
Pfam:Crisp 200 254 4.8e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115340
AA Change: Y190C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110997
Gene: ENSMUSG00000025774
AA Change: Y190C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCP 40 184 1.32e-45 SMART
Pfam:Crisp 196 250 6.2e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115344
AA Change: Y233C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111001
Gene: ENSMUSG00000025774
AA Change: Y233C

DomainStartEndE-ValueType
transmembrane domain 39 61 N/A INTRINSIC
SCP 83 227 1.32e-45 SMART
Pfam:Crisp 239 293 1.6e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130669
Meta Mutation Damage Score 0.8988 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fertilization consists of a sequence of specific cell-cell interactions culminating in the fusion of the sperm and egg plasma membranes. Recognition, binding, and fusion occur through the interaction of complementary molecules that are localized to specific domains of the sperm and egg plasma membranes. In the sperm, the postacrosomal region or equatorial segment is involved in sperm-egg plasma membrane fusion. The protein encoded by this gene is a member of the cysteine-rich secretory protein (CRISP) family. It is expressed in the epididymis, is secreted into the epididymal lumen, and binds to the postacrosomal region of the sperm head, where it plays a role in sperm-egg fusion. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a null mutation display an impaired acrosome reaction in response to progesterone but are fertile with normal testis morphology and weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
9030619P08Rik A C 15: 75,429,997 noncoding transcript Het
Aldh1l2 T C 10: 83,496,025 I639V probably benign Het
Ambra1 T C 2: 91,770,896 probably benign Het
Ap5z1 T C 5: 142,470,114 Y299H probably damaging Het
Atp6v1b1 A T 6: 83,756,544 probably benign Het
Atr G A 9: 95,950,636 V2574I probably benign Het
Atxn1l T A 8: 109,732,980 T217S probably benign Het
Ccdc85a A G 11: 28,396,150 S89P probably benign Het
Cd209e A T 8: 3,849,124 I196N probably damaging Het
Cdhr4 A G 9: 107,995,296 S247G probably benign Het
Cntn6 A T 6: 104,832,509 I502F probably damaging Het
Ctsb C A 14: 63,139,104 T261N probably benign Het
Ctsk T C 3: 95,500,874 F14L probably benign Het
Dchs1 T C 7: 105,758,178 I2110V probably damaging Het
Dennd5b A G 6: 149,068,490 M155T probably benign Het
Echdc3 T C 2: 6,212,800 D54G probably benign Het
Egln3 G A 12: 54,181,693 T209I probably damaging Het
Fbn1 A C 2: 125,372,527 probably benign Het
Fkbp15 A T 4: 62,304,609 S1018T possibly damaging Het
Flnb T C 14: 7,896,503 I898T probably benign Het
Flt1 T A 5: 147,599,646 Y795F probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fryl A G 5: 73,064,925 probably benign Het
Fryl T C 5: 73,110,271 E417G probably damaging Het
Gcnt3 T C 9: 70,034,333 I318V probably benign Het
Gm11437 T A 11: 84,164,628 H54L possibly damaging Het
Huwe1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA X: 151,907,048 probably benign Het
Jarid2 G A 13: 44,884,892 probably benign Het
Kif5b A T 18: 6,214,044 V653E probably benign Het
Kmt2b A G 7: 30,574,940 V2113A probably damaging Het
Knl1 C T 2: 119,072,573 T1585I probably benign Het
Mlxipl T A 5: 135,132,718 M497K probably benign Het
Mre11a T A 9: 14,799,639 W210R probably damaging Het
Mrps22 A G 9: 98,594,695 V207A probably benign Het
Myo15 A G 11: 60,499,430 I2111V possibly damaging Het
Myo1a C T 10: 127,719,279 P838L probably benign Het
Nbea T A 3: 56,058,040 H484L probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nlrp2 T A 7: 5,328,431 D322V probably damaging Het
Nrcam T C 12: 44,590,164 C1057R probably damaging Het
Ntsr1 T C 2: 180,500,601 S62P probably damaging Het
Nudt18 A G 14: 70,579,427 H157R probably benign Het
Olfr1002 T A 2: 85,647,560 T254S probably damaging Het
Olfr982 C A 9: 40,074,896 N200K probably damaging Het
Sidt2 T C 9: 45,945,704 T435A probably damaging Het
Snx27 T C 3: 94,520,233 T312A probably benign Het
Srebf2 T C 15: 82,177,519 S429P probably damaging Het
Suclg2 A G 6: 95,497,582 probably benign Het
Tchh A T 3: 93,444,972 E573V unknown Het
Tdrd1 A G 19: 56,861,760 T985A probably benign Het
Ttc7b A G 12: 100,403,439 I357T possibly damaging Het
Ttn T C 2: 76,795,664 E13271G probably damaging Het
Usp13 A G 3: 32,915,708 E661G probably damaging Het
Vasp T G 7: 19,259,033 probably benign Het
Vmn2r109 A T 17: 20,555,241 Y75N possibly damaging Het
Vmn2r15 T A 5: 109,292,904 N363Y probably damaging Het
Vmn2r60 T A 7: 42,137,052 N426K probably benign Het
Wisp2 T A 2: 163,829,077 M168K unknown Het
Znhit2 C A 19: 6,062,258 N344K probably damaging Het
Other mutations in Crisp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00974:Crisp4 APN 1 18128647 missense probably damaging 1.00
IGL01071:Crisp4 APN 1 18137007 missense probably benign 0.41
IGL01641:Crisp4 APN 1 18124290 missense possibly damaging 0.91
IGL01670:Crisp4 APN 1 18128677 missense probably benign 0.03
IGL01985:Crisp4 APN 1 18134065 missense probably damaging 1.00
IGL02043:Crisp4 APN 1 18134100 missense probably damaging 1.00
R1978:Crisp4 UTSW 1 18128665 missense probably benign 0.04
R5269:Crisp4 UTSW 1 18128710 missense probably damaging 1.00
R5736:Crisp4 UTSW 1 18115715 missense probably benign 0.03
R6154:Crisp4 UTSW 1 18122788 missense possibly damaging 0.80
R6999:Crisp4 UTSW 1 18137035 missense possibly damaging 0.56
R7255:Crisp4 UTSW 1 18130231 missense probably damaging 0.99
R7446:Crisp4 UTSW 1 18122738 missense probably damaging 1.00
R7800:Crisp4 UTSW 1 18128749 missense probably benign 0.02
R7831:Crisp4 UTSW 1 18128789 missense probably benign 0.29
R7881:Crisp4 UTSW 1 18128669 missense probably benign 0.07
R8053:Crisp4 UTSW 1 18124274 missense probably benign 0.19
R8881:Crisp4 UTSW 1 18115678 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGACCGCAGGTCAATGCTTCAC -3'
(R):5'- CCAGAGCCCTGTTAGAACATGACTG -3'

Sequencing Primer
(F):5'- GCAGGTCAATGCTTCACTTAAAGG -3'
(R):5'- AGTGCTCCTAGCCATGAATC -3'
Posted On2014-01-29