Incidental Mutation 'R1241:Olfr1002'
ID151973
Institutional Source Beutler Lab
Gene Symbol Olfr1002
Ensembl Gene ENSMUSG00000075214
Gene Nameolfactory receptor 1002
SynonymsGA_x6K02T2Q125-47127746-47126790, MOR175-2
MMRRC Submission 039308-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R1241 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85646057-85650704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85647560 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 254 (T254S)
Ref Sequence ENSEMBL: ENSMUSP00000150405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099920] [ENSMUST00000215548]
Predicted Effect probably damaging
Transcript: ENSMUST00000099920
AA Change: T254S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097504
Gene: ENSMUSG00000075214
AA Change: T254S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.7e-50 PFAM
Pfam:7tm_1 41 290 2.5e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215548
AA Change: T254S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
9030619P08Rik A C 15: 75,429,997 noncoding transcript Het
Aldh1l2 T C 10: 83,496,025 I639V probably benign Het
Ambra1 T C 2: 91,770,896 probably benign Het
Ap5z1 T C 5: 142,470,114 Y299H probably damaging Het
Atp6v1b1 A T 6: 83,756,544 probably benign Het
Atr G A 9: 95,950,636 V2574I probably benign Het
Atxn1l T A 8: 109,732,980 T217S probably benign Het
Ccdc85a A G 11: 28,396,150 S89P probably benign Het
Cd209e A T 8: 3,849,124 I196N probably damaging Het
Cdhr4 A G 9: 107,995,296 S247G probably benign Het
Cntn6 A T 6: 104,832,509 I502F probably damaging Het
Crisp4 T C 1: 18,122,794 Y233C probably damaging Het
Ctsb C A 14: 63,139,104 T261N probably benign Het
Ctsk T C 3: 95,500,874 F14L probably benign Het
Dchs1 T C 7: 105,758,178 I2110V probably damaging Het
Dennd5b A G 6: 149,068,490 M155T probably benign Het
Echdc3 T C 2: 6,212,800 D54G probably benign Het
Egln3 G A 12: 54,181,693 T209I probably damaging Het
Fbn1 A C 2: 125,372,527 probably benign Het
Fkbp15 A T 4: 62,304,609 S1018T possibly damaging Het
Flnb T C 14: 7,896,503 I898T probably benign Het
Flt1 T A 5: 147,599,646 Y795F probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fryl A G 5: 73,064,925 probably benign Het
Fryl T C 5: 73,110,271 E417G probably damaging Het
Gcnt3 T C 9: 70,034,333 I318V probably benign Het
Gm11437 T A 11: 84,164,628 H54L possibly damaging Het
Huwe1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA X: 151,907,048 probably benign Het
Jarid2 G A 13: 44,884,892 probably benign Het
Kif5b A T 18: 6,214,044 V653E probably benign Het
Kmt2b A G 7: 30,574,940 V2113A probably damaging Het
Knl1 C T 2: 119,072,573 T1585I probably benign Het
Mlxipl T A 5: 135,132,718 M497K probably benign Het
Mre11a T A 9: 14,799,639 W210R probably damaging Het
Mrps22 A G 9: 98,594,695 V207A probably benign Het
Myo15 A G 11: 60,499,430 I2111V possibly damaging Het
Myo1a C T 10: 127,719,279 P838L probably benign Het
Nbea T A 3: 56,058,040 H484L probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nlrp2 T A 7: 5,328,431 D322V probably damaging Het
Nrcam T C 12: 44,590,164 C1057R probably damaging Het
Ntsr1 T C 2: 180,500,601 S62P probably damaging Het
Nudt18 A G 14: 70,579,427 H157R probably benign Het
Olfr982 C A 9: 40,074,896 N200K probably damaging Het
Sidt2 T C 9: 45,945,704 T435A probably damaging Het
Snx27 T C 3: 94,520,233 T312A probably benign Het
Srebf2 T C 15: 82,177,519 S429P probably damaging Het
Suclg2 A G 6: 95,497,582 probably benign Het
Tchh A T 3: 93,444,972 E573V unknown Het
Tdrd1 A G 19: 56,861,760 T985A probably benign Het
Ttc7b A G 12: 100,403,439 I357T possibly damaging Het
Ttn T C 2: 76,795,664 E13271G probably damaging Het
Usp13 A G 3: 32,915,708 E661G probably damaging Het
Vasp T G 7: 19,259,033 probably benign Het
Vmn2r109 A T 17: 20,555,241 Y75N possibly damaging Het
Vmn2r15 T A 5: 109,292,904 N363Y probably damaging Het
Vmn2r60 T A 7: 42,137,052 N426K probably benign Het
Wisp2 T A 2: 163,829,077 M168K unknown Het
Znhit2 C A 19: 6,062,258 N344K probably damaging Het
Other mutations in Olfr1002
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02591:Olfr1002 APN 2 85648143 missense probably damaging 0.98
IGL02873:Olfr1002 APN 2 85647752 missense possibly damaging 0.50
PIT4362001:Olfr1002 UTSW 2 85647724 missense probably damaging 1.00
R1261:Olfr1002 UTSW 2 85647799 missense probably damaging 1.00
R1666:Olfr1002 UTSW 2 85647813 nonsense probably null
R1902:Olfr1002 UTSW 2 85647857 missense possibly damaging 0.81
R1965:Olfr1002 UTSW 2 85647746 missense possibly damaging 0.94
R2096:Olfr1002 UTSW 2 85648090 missense probably benign 0.20
R4239:Olfr1002 UTSW 2 85648303 missense probably damaging 0.98
R4730:Olfr1002 UTSW 2 85647992 missense probably benign 0.39
R4948:Olfr1002 UTSW 2 85647572 missense probably benign 0.30
R5627:Olfr1002 UTSW 2 85647647 missense probably damaging 1.00
R5844:Olfr1002 UTSW 2 85647895 missense probably benign 0.36
R6809:Olfr1002 UTSW 2 85647973 missense probably damaging 1.00
R7399:Olfr1002 UTSW 2 85647424 missense possibly damaging 0.89
R7476:Olfr1002 UTSW 2 85648168 missense not run
R7805:Olfr1002 UTSW 2 85647450 nonsense probably null
R7960:Olfr1002 UTSW 2 85648073 missense possibly damaging 0.82
R8015:Olfr1002 UTSW 2 85647792 missense probably damaging 0.99
R8355:Olfr1002 UTSW 2 85648141 missense probably damaging 1.00
R8455:Olfr1002 UTSW 2 85648141 missense probably damaging 1.00
R8479:Olfr1002 UTSW 2 85648103 missense probably damaging 1.00
R8683:Olfr1002 UTSW 2 85648066 missense probably benign 0.35
R8699:Olfr1002 UTSW 2 85647986 missense possibly damaging 0.87
R8762:Olfr1002 UTSW 2 85647690 missense probably damaging 1.00
R8897:Olfr1002 UTSW 2 85647843 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGGGAACACACCCAACATTAAGCATTAT -3'
(R):5'- ACATTTGCTTTTCATCATGGCTGGGAT -3'

Sequencing Primer
(F):5'- GGAAATGGCCTTCTGTAAACC -3'
(R):5'- ATCAATTCTGCTGATGGGAGGC -3'
Posted On2014-01-29