Incidental Mutation 'R1236:Sgcg'
ID152442
Institutional Source Beutler Lab
Gene Symbol Sgcg
Ensembl Gene ENSMUSG00000035296
Gene Namesarcoglycan, gamma (dystrophin-associated glycoprotein)
Synonymsgamma-SG, 5430420E18Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R1236 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location61219115-61258490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61245770 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 61 (M61V)
Ref Sequence ENSEMBL: ENSMUSP00000112576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077954] [ENSMUST00000121148]
Predicted Effect probably damaging
Transcript: ENSMUST00000077954
AA Change: M61V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077106
Gene: ENSMUSG00000035296
AA Change: M61V

DomainStartEndE-ValueType
Pfam:Sarcoglycan_1 25 280 1.2e-81 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121148
AA Change: M61V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112576
Gene: ENSMUSG00000035296
AA Change: M61V

DomainStartEndE-ValueType
Pfam:Sarcoglycan_1 23 284 1.1e-106 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes gamma-sarcoglycan, one of several sarcolemmal transmembrane glycoproteins that interact with dystrophin. The dystrophin-glycoprotein complex (DGC) spans the sarcolemma and is comprised of dystrophin, syntrophin, alpha- and beta-dystroglycans and sarcoglycans. The DGC provides a structural link between the subsarcolemmal cytoskeleton and the extracellular matrix of muscle cells. Defects in the encoded protein can lead to early onset autosomal recessive muscular dystrophy, in particular limb-girdle muscular dystrophy, type 2C (LGMD2C). [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in muscles and heart similar to muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,795,744 Y360C probably damaging Het
Afap1l2 T A 19: 56,916,472 H566L possibly damaging Het
Aqr G T 2: 114,116,655 F1015L probably damaging Het
Atp5s T C 12: 69,741,818 probably null Het
Cep112 T A 11: 108,859,374 L901H probably damaging Het
Col26a1 A G 5: 136,754,926 V229A probably benign Het
Cyp4a14 T C 4: 115,492,170 N231S probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm37240 T A 3: 84,527,696 N13I probably benign Het
Kbtbd7 G T 14: 79,427,832 C368F probably benign Het
Kyat3 A G 3: 142,738,259 D418G probably benign Het
Lpcat2 A G 8: 92,886,569 M246V probably damaging Het
Nbas T A 12: 13,269,241 W31R probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Npepl1 T A 2: 174,114,480 probably null Het
Olfr805 A G 10: 129,722,806 V246A probably damaging Het
Olfr906 T C 9: 38,488,229 S67P probably damaging Het
P4ha3 T C 7: 100,293,849 L147P probably damaging Het
Pkp2 C A 16: 16,225,902 H173Q probably benign Het
Prlr C A 15: 10,325,281 T180K probably benign Het
Psph A G 5: 129,771,476 M47T probably damaging Het
Rufy2 A G 10: 62,994,770 N217S probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spint1 A G 2: 119,245,573 T217A probably benign Het
Tert T C 13: 73,636,379 L648P probably damaging Het
Vwde A T 6: 13,187,153 Y778* probably null Het
Zeb2 T A 2: 44,994,646 D967V probably damaging Het
Zfp687 T C 3: 95,012,044 N139S probably benign Het
Zscan26 T C 13: 21,445,770 M188V probably benign Het
Other mutations in Sgcg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Sgcg APN 14 61240347 nonsense probably null
IGL00159:Sgcg APN 14 61232475 missense probably benign 0.00
R0466:Sgcg UTSW 14 61221686 missense probably damaging 1.00
R1870:Sgcg UTSW 14 61240447 splice site probably benign
R1879:Sgcg UTSW 14 61236897 critical splice acceptor site probably null
R1933:Sgcg UTSW 14 61232412 missense possibly damaging 0.77
R2090:Sgcg UTSW 14 61245764 missense probably damaging 0.99
R2937:Sgcg UTSW 14 61229625 missense probably damaging 1.00
R2938:Sgcg UTSW 14 61229625 missense probably damaging 1.00
R3508:Sgcg UTSW 14 61221746 missense probably benign
R5345:Sgcg UTSW 14 61245769 missense probably damaging 0.99
R5464:Sgcg UTSW 14 61236855 missense possibly damaging 0.65
R5582:Sgcg UTSW 14 61225305 missense probably damaging 1.00
R7259:Sgcg UTSW 14 61225217 missense probably benign 0.30
R7335:Sgcg UTSW 14 61240367 missense probably damaging 1.00
R8339:Sgcg UTSW 14 61232517 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTAGATGAGAGCAGACATGCAAACACT -3'
(R):5'- GGTCACCGAGGGCACTCACATA -3'

Sequencing Primer
(F):5'- TGACAACATGAGGAAAATCCAGTTC -3'
(R):5'- CTCACATAGAGAGGCCCGAG -3'
Posted On2014-01-29