Incidental Mutation 'R1349:Dbpht2'
ID156615
Institutional Source Beutler Lab
Gene Symbol Dbpht2
Ensembl Gene ENSMUSG00000029878
Gene NameDNA binding protein with his-thr domain
SynonymsSpot2
MMRRC Submission 039414-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R1349 (G1)
Quality Score138
Status Not validated
Chromosome12
Chromosomal Location74297474-74300468 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) C to CNNNNNNNNNNNNNNNNNN at 74299062 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000072100
SMART Domains Protein: ENSMUSP00000071973
Gene: ENSMUSG00000029878

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 85 102 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000095617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221311
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.8%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik G A 8: 124,861,253 T36I possibly damaging Het
Adcy2 T A 13: 68,668,533 N778I probably damaging Het
Ak5 G T 3: 152,533,434 D301E probably damaging Het
Akap13 G A 7: 75,609,592 G655S possibly damaging Het
Ankrd28 A T 14: 31,745,261 M248K probably benign Het
Atf7ip2 G A 16: 10,234,331 V225I probably damaging Het
Ccdc151 C T 9: 21,993,620 R290H probably damaging Het
Ccdc157 A T 11: 4,149,056 I48N probably benign Het
Cd209d C A 8: 3,878,515 probably benign Het
Cecr2 G A 6: 120,757,603 G613E probably damaging Het
Clspn C T 4: 126,563,977 A98V probably benign Het
Cntnap5b G A 1: 100,164,088 D499N probably benign Het
Cox7a2 G A 9: 79,758,537 R21* probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dlg1 T C 16: 31,812,820 I208T probably damaging Het
Dmxl1 A T 18: 49,888,853 N1612Y probably damaging Het
Epha3 A G 16: 63,611,053 I495T possibly damaging Het
Frem1 T C 4: 82,922,305 probably benign Het
Glipr1 A G 10: 111,993,532 V108A probably benign Het
Gm4778 A G 3: 94,266,128 T148A possibly damaging Het
Gpatch2l T C 12: 86,260,709 L287P possibly damaging Het
Hp T G 8: 109,575,306 K337Q probably benign Het
Htr1a T A 13: 105,445,366 C371* probably null Het
Leo1 T C 9: 75,449,469 V377A possibly damaging Het
Lsg1 A G 16: 30,564,654 F583L possibly damaging Het
Map4k4 C A 1: 40,021,159 P1103Q probably damaging Het
Mybph T C 1: 134,193,615 S38P probably benign Het
Myo1e T G 9: 70,287,069 probably benign Het
Nefh T TNNNNNNNNNNNNNNNNNN 11: 4,941,010 probably benign Het
Oca2 T A 7: 56,535,968 M814K probably benign Het
Pkd1 T C 17: 24,575,266 C1976R probably damaging Het
Pogz T A 3: 94,860,888 L126M probably damaging Het
Rec8 T C 14: 55,618,974 Y68H probably damaging Het
Ryr3 T A 2: 112,834,201 S1582C probably damaging Het
Sh3pxd2a A T 19: 47,267,721 W853R probably damaging Het
Slc6a7 C T 18: 61,000,543 G527D probably benign Het
Tgm1 A G 14: 55,711,201 probably benign Het
Tnxb T C 17: 34,710,293 V2770A possibly damaging Het
Togaram1 T A 12: 65,011,145 M1502K probably damaging Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Vmn2r102 A T 17: 19,660,625 probably benign Het
Vmn2r12 T C 5: 109,086,586 M587V probably benign Het
Vmn2r63 A G 7: 42,929,218 F84L possibly damaging Het
Wdr35 A T 12: 9,019,870 probably benign Het
Wdr73 C A 7: 80,893,252 V176L probably damaging Het
Other mutations in Dbpht2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0919:Dbpht2 UTSW 12 74299000 exon noncoding transcript
R1639:Dbpht2 UTSW 12 74299158 exon noncoding transcript
R1813:Dbpht2 UTSW 12 74295850 unclassified noncoding transcript
R1976:Dbpht2 UTSW 12 74295861 unclassified noncoding transcript
R4451:Dbpht2 UTSW 12 74299032 exon noncoding transcript
R4541:Dbpht2 UTSW 12 74299160 exon noncoding transcript
R4650:Dbpht2 UTSW 12 74299159 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGGAGACTCATGCAAGTATGCACAC -3'
(R):5'- CATGGCTGAATCCATCCACTCAGG -3'

Sequencing Primer
(F):5'- acacacaaacacacagacatac -3'
(R):5'- ATCCACTCAGGCGGCAG -3'
Posted On2014-02-11