Mutagenetix > Incidental Mutations

Incidental Mutation 'R1437:Pde4a'

161301

Institutional Source

Beutler Lab

Gene Symbol

Pde4a

Ensembl Gene

ENSMUSG00000032177

Gene Name

phosphodiesterase 4A, cAMP specific

Synonyms

Dpde2, dunce, D9Ertd60e

MMRRC Submission

039492-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.262) question?

Stock #

R1437 (G1)

Quality Score

100

Status

Not validated

Chromosome

Chromosomal Location

21165714-21213248 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 21192592 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000111118 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003395] [ENSMUST00000039413] [ENSMUST00000115458] [ENSMUST00000115458]

Predicted Effect

probably benign
Transcript: ENSMUST00000003395

SMART Domains

Protein: ENSMUSP00000003395
Gene: ENSMUSG00000032177

Domain	Start	End	E-Value	Type
low complexity region	62	87	N/A	INTRINSIC
HDc	182	357	7.12e-5	SMART
low complexity region	462	475	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000039413

SMART Domains

Protein: ENSMUSP00000037025
Gene: ENSMUSG00000032177

Domain	Start	End	E-Value	Type
low complexity region	35	46	N/A	INTRINSIC
low complexity region	92	102	N/A	INTRINSIC
low complexity region	296	321	N/A	INTRINSIC
HDc	416	591	7.12e-5	SMART
low complexity region	696	709	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115458

SMART Domains

Protein: ENSMUSP00000111118
Gene: ENSMUSG00000032177

Domain	Start	End	E-Value	Type
low complexity region	5	20	N/A	INTRINSIC
low complexity region	239	264	N/A	INTRINSIC
HDc	359	534	7.12e-5	SMART
low complexity region	639	652	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115458

SMART Domains

Protein: ENSMUSP00000111118
Gene: ENSMUSG00000032177

Domain	Start	End	E-Value	Type
low complexity region	5	20	N/A	INTRINSIC
low complexity region	239	264	N/A	INTRINSIC
HDc	359	534	7.12e-5	SMART
low complexity region	639	652	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127821

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131769

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140440

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 94.7%
20x: 87.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE4 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygous null mice have a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	A	3: 36,942,429	H1097N	possibly damaging	Het
Abcb1b	T	A	5: 8,821,436	V330E	possibly damaging	Het
Abcb5	A	G	12: 118,874,762	S1022P	probably damaging	Het
Abcc8	A	G	7: 46,179,813	I46T	probably damaging	Het
Add3	A	G	19: 53,233,678	R275G	probably damaging	Het
Akap1	C	A	11: 88,844,751	G362*	probably null	Het
Arhgef4	A	G	1: 34,723,945	T761A	unknown	Het
Asap1	A	T	15: 64,120,107	L751Q	probably damaging	Het
Atg2a	C	A	19: 6,250,616	P741H	probably damaging	Het
Atxn10	T	C	15: 85,359,474	I46T	possibly damaging	Het
BC049715	C	A	6: 136,840,092	A110E	probably damaging	Het
Btbd7	T	A	12: 102,788,090	T806S	possibly damaging	Het
Cdk4	C	A	10: 127,064,689	P108H	probably damaging	Het
Cep290	A	G	10: 100,572,101	T2391A	probably benign	Het
Col6a3	G	T	1: 90,801,376	A1281E	probably damaging	Het
Cpa5	A	T	6: 30,624,655	I165F	probably damaging	Het
Ctdp1	G	T	18: 80,450,213	Q356K	probably benign	Het
Ddx21	A	G	10: 62,598,590	M130T	unknown	Het
Epha5	T	G	5: 84,233,696	D432A	probably damaging	Het
Esr1	ACGCCGCCGCCGCCGCCGCCGCCGCCGCC	ACGCCGCCGCCGCCGCCGCCGCCGCC	10: 4,712,571		probably benign	Het
Fads2	A	T	19: 10,091,829	L77Q	probably benign	Het
Fbn2	A	T	18: 58,053,659	H1723Q	possibly damaging	Het
Fbxo42	C	T	4: 141,167,854	H43Y	probably benign	Het
Fry	A	G	5: 150,310,425	T121A	possibly damaging	Het
Gpr156	T	G	16: 37,988,542	S209A	probably damaging	Het
Hey2	T	C	10: 30,833,849	T303A	probably benign	Het
Hivep1	T	A	13: 42,157,140	M952K	probably benign	Het
Hrasls	C	A	16: 29,228,170	A147E	possibly damaging	Het
Hydin	C	T	8: 110,581,985	Q3968*	probably null	Het
Jup	T	C	11: 100,383,576	E96G	probably benign	Het
Kcnn1	A	G	8: 70,844,551	I504T	probably benign	Het
Klk1b9	T	C	7: 43,979,690	V174A	probably damaging	Het
Lama3	G	C	18: 12,549,227	M1083I	possibly damaging	Het
Lcmt2	A	G	2: 121,138,896	S569P	probably benign	Het
Lrfn2	T	C	17: 49,071,225	S445P	probably damaging	Het
Lrp3	C	A	7: 35,213,170	G31W	probably damaging	Het
Lrrc8b	T	C	5: 105,481,702	L638P	probably damaging	Het
Mief2	C	T	11: 60,730,943	T113M	probably benign	Het
Mrps2	T	C	2: 28,468,887	F76S	probably damaging	Het
Naca	A	G	10: 128,042,179		probably benign	Het
Ndst4	C	A	3: 125,561,450	R336S	probably damaging	Het
Nr1i3	CACTCAACACTAC	CAC	1: 171,217,141		probably null	Het
Nr5a1	T	A	2: 38,710,673	T29S	probably benign	Het
Olfr1111	C	T	2: 87,149,771	V297M	possibly damaging	Het
Olfr993	T	C	2: 85,414,874	I2V	probably benign	Het
Pald1	A	G	10: 61,341,285	F662S	possibly damaging	Het
Pdcd4	G	T	19: 53,909,243	A59S	probably damaging	Het
Pkd1	T	A	17: 24,595,132	S4159T	probably damaging	Het
Plch1	C	A	3: 63,697,533	R1641L	probably benign	Het
Plec	G	T	15: 76,189,281	P308Q	probably damaging	Het
Pnkp	A	G	7: 44,860,402	S262G	possibly damaging	Het
Pou2f1	A	G	1: 165,891,830	V504A	probably damaging	Het
Prepl	G	A	17: 85,088,357	R66W	probably damaging	Het
Rasgrf2	T	C	13: 92,030,888	K226E	probably damaging	Het
Ror1	T	A	4: 100,412,109	F381L	probably benign	Het
Sbsn	C	T	7: 30,753,053	Q498*	probably null	Het
Scgb2b19	T	C	7: 33,278,555	I106V	probably benign	Het
Sf3a2	G	A	10: 80,804,206		probably benign	Het
Sis	T	C	3: 72,934,142	H780R	probably damaging	Het
Slc28a3	G	T	13: 58,558,575	C617*	probably null	Het
Slc44a1	T	A	4: 53,561,006	V574D	probably damaging	Het
Slc8a3	T	A	12: 81,315,986	T20S	probably damaging	Het
Stt3b	T	A	9: 115,254,927	I394F	probably damaging	Het
Ubap1l	T	A	9: 65,372,055	V212D	possibly damaging	Het
Ugt2b35	T	C	5: 87,001,031	V47A	probably benign	Het
Vmn2r114	A	G	17: 23,291,211	F765S	probably damaging	Het
Vps50	C	T	6: 3,517,852	Q97*	probably null	Het
Vsig10	A	G	5: 117,351,570	Q467R	probably damaging	Het
Wdsub1	T	G	2: 59,878,133	Y11S	probably damaging	Het
Zbtb11	T	G	16: 55,991,620		probably null	Het

Other mutations in Pde4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Pde4a	APN	9	21211061	missense	probably benign	0.01
IGL01330:Pde4a	APN	9	21192438	splice site	probably benign
IGL01403:Pde4a	APN	9	21205116	missense	probably damaging	1.00
IGL01610:Pde4a	APN	9	21211350	utr 3 prime	probably benign
IGL02010:Pde4a	APN	9	21203554	critical splice donor site	probably null
IGL02296:Pde4a	APN	9	21192569	missense	possibly damaging	0.94
IGL02637:Pde4a	APN	9	21201332	missense	probably damaging	0.97
PIT4696001:Pde4a	UTSW	9	21211001	missense	probably benign
R0032:Pde4a	UTSW	9	21201432	splice site	probably benign
R0032:Pde4a	UTSW	9	21201432	splice site	probably benign
R0257:Pde4a	UTSW	9	21192421	missense	probably damaging	1.00
R0504:Pde4a	UTSW	9	21204403	missense	probably damaging	1.00
R1524:Pde4a	UTSW	9	21201247	missense	probably damaging	0.98
R1750:Pde4a	UTSW	9	21203232	missense	probably damaging	1.00
R2239:Pde4a	UTSW	9	21211268	missense	probably damaging	1.00
R2905:Pde4a	UTSW	9	21201349	missense	probably benign	0.01
R2991:Pde4a	UTSW	9	21203243	missense	probably damaging	0.96
R3972:Pde4a	UTSW	9	21206217	missense	probably damaging	1.00
R4826:Pde4a	UTSW	9	21192380	splice site	probably null
R4922:Pde4a	UTSW	9	21210713	missense	probably damaging	1.00
R5195:Pde4a	UTSW	9	21204333	missense	possibly damaging	0.70
R5208:Pde4a	UTSW	9	21203558	splice site	probably null
R5552:Pde4a	UTSW	9	21201386	missense	probably damaging	1.00
R5713:Pde4a	UTSW	9	21203517	missense	probably damaging	1.00
R6722:Pde4a	UTSW	9	21211225	missense	probably damaging	1.00
R6792:Pde4a	UTSW	9	21192590	missense	probably benign	0.03
R6861:Pde4a	UTSW	9	21205301	missense	probably damaging	1.00
R6901:Pde4a	UTSW	9	21204970	missense	probably benign	0.37
R7300:Pde4a	UTSW	9	21206322	missense	probably damaging	1.00
R7690:Pde4a	UTSW	9	21166004	missense	probably damaging	1.00
R7798:Pde4a	UTSW	9	21198663	missense	possibly damaging	0.63
R8073:Pde4a	UTSW	9	21210769	missense	probably damaging	1.00
R8133:Pde4a	UTSW	9	21191377	missense	possibly damaging	0.87
R8167:Pde4a	UTSW	9	21206173	missense	possibly damaging	0.95
R8297:Pde4a	UTSW	9	21166108	missense	possibly damaging	0.94
R8348:Pde4a	UTSW	9	21206238	missense	probably benign	0.35
R8448:Pde4a	UTSW	9	21206238	missense	probably benign	0.35
X0027:Pde4a	UTSW	9	21198654	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGACCTCATTGTGACCCCGTTTG -3'
(R):5'- CATCGTTGTCGTCATCACTGGGAG -3'

Sequencing Primer
(F):5'- TTTGCCCAGGTGAGACCTC -3'
(R):5'- tcttttcctcccctggagac -3'

Posted On

2014-03-14