Incidental Mutation 'R1454:Bfsp2'
ID162210
Institutional Source Beutler Lab
Gene Symbol Bfsp2
Ensembl Gene ENSMUSG00000032556
Gene Namebeaded filament structural protein 2, phakinin
SynonymsCP49
MMRRC Submission 039509-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R1454 (G1)
Quality Score124
Status Validated
Chromosome9
Chromosomal Location103424924-103480420 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 103480225 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000116249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049452] [ENSMUST00000124310] [ENSMUST00000189066] [ENSMUST00000189588]
Predicted Effect probably benign
Transcript: ENSMUST00000049452
SMART Domains Protein: ENSMUSP00000046021
Gene: ENSMUSG00000042757

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:TMEM108 61 574 1.6e-275 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124310
AA Change: M1K

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116249
Gene: ENSMUSG00000032556
AA Change: M1K

DomainStartEndE-ValueType
Filament 102 416 6.85e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144420
Predicted Effect probably benign
Transcript: ENSMUST00000189066
SMART Domains Protein: ENSMUSP00000141160
Gene: ENSMUSG00000042757

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 132 179 N/A INTRINSIC
low complexity region 292 314 N/A INTRINSIC
low complexity region 391 410 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189588
SMART Domains Protein: ENSMUSP00000140027
Gene: ENSMUSG00000042757

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 132 179 N/A INTRINSIC
low complexity region 292 314 N/A INTRINSIC
low complexity region 391 410 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191069
Meta Mutation Damage Score 0.306 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] More than 99% of the vertebrate ocular lens is comprised of terminally differentiated lens fiber cells. Two lens-specific intermediate filament-like proteins, the protein product of this gene (phakinin), and filensin, are expressed only after fiber cell differentiation has begun. Both proteins are found in a structurally unique cytoskeletal element that is referred to as the beaded filament (BF). Mutations in this gene have been associated with juvenile-onset, progressive cataracts and Dowling-Meara epidermolysis bullosa simplex. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mutations at this locus result in eye abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,869,993 V537A possibly damaging Het
Adcy10 A T 1: 165,515,380 I272F possibly damaging Het
Adcy6 A G 15: 98,604,728 S2P probably damaging Het
Agap1 A G 1: 89,837,806 probably null Het
Aldh3a2 A G 11: 61,265,102 V116A probably benign Het
Ankdd1b A T 13: 96,433,405 probably null Het
Antxrl G A 14: 34,060,949 V233I probably damaging Het
Atp8b5 A G 4: 43,302,590 I38V probably benign Het
Atxn7l2 A G 3: 108,208,432 probably benign Het
Camsap3 T A 8: 3,603,968 I520N possibly damaging Het
Cenpc1 C T 5: 86,013,510 V854I possibly damaging Het
Csnk2a1 T C 2: 152,257,427 L88S probably damaging Het
Dcaf17 A G 2: 71,073,173 N171D probably damaging Het
Dctn1 G C 6: 83,197,508 A1077P possibly damaging Het
Dock1 T C 7: 134,851,609 probably benign Het
Egfr A T 11: 16,889,920 I645L probably benign Het
Gdpd1 T G 11: 87,059,509 K79N possibly damaging Het
Ggt5 A T 10: 75,609,908 L432F probably benign Het
Gm11060 A G 2: 105,093,752 T22A unknown Het
Gpr132 G A 12: 112,852,240 T322I possibly damaging Het
Grin1 G A 2: 25,292,430 R940* probably null Het
Hip1 T C 5: 135,438,632 T316A probably benign Het
Hnrnpm A G 17: 33,666,488 probably benign Het
Hsd3b5 G A 3: 98,619,530 T200I probably benign Het
Hspa9 A T 18: 34,938,606 L647H probably damaging Het
Itgad T C 7: 128,192,137 I727T probably benign Het
Kcnma1 T C 14: 23,463,200 D522G probably damaging Het
Lipf C T 19: 33,970,732 probably benign Het
Ly6i T C 15: 74,983,055 D2G possibly damaging Het
Mast1 G A 8: 84,920,635 P631L probably damaging Het
Mmp1b G C 9: 7,386,693 L144V probably damaging Het
Msh6 A G 17: 87,984,758 S314G probably benign Het
Myo5c G A 9: 75,263,066 V493I possibly damaging Het
Nefm A G 14: 68,121,379 L402P probably damaging Het
Nrxn2 T C 19: 6,481,446 F697S probably damaging Het
Olfr156 A T 4: 43,820,639 C241S probably damaging Het
Pex13 A G 11: 23,649,422 I363T probably benign Het
Plcb3 T C 19: 6,955,046 R1082G possibly damaging Het
Psg28 A T 7: 18,427,964 S205T possibly damaging Het
Pxt1 C A 17: 28,934,782 V26L possibly damaging Het
Ripk2 G A 4: 16,163,239 T53M probably damaging Het
Slc5a9 A G 4: 111,883,964 V495A probably benign Het
Snrpa T C 7: 27,192,937 K66R probably benign Het
Srgap1 T A 10: 121,896,738 E145V probably damaging Het
Suz12 A G 11: 80,032,113 T694A probably benign Het
Tatdn2 T A 6: 113,704,327 D440E probably benign Het
Tbc1d21 A G 9: 58,362,813 probably null Het
Tbc1d31 T A 15: 57,951,638 Y570* probably null Het
Tbc1d32 A T 10: 56,177,479 probably benign Het
Tdrd5 G C 1: 156,259,836 Q839E probably benign Het
Tecpr2 A G 12: 110,968,953 N1402S probably benign Het
Thbs1 A G 2: 118,122,672 D921G probably damaging Het
Tll1 A G 8: 64,038,490 V803A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm4 T C 7: 45,317,056 E461G probably damaging Het
Zp3 T A 5: 135,984,188 I152N probably damaging Het
Other mutations in Bfsp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Bfsp2 APN 9 103453098 missense possibly damaging 0.90
IGL01160:Bfsp2 APN 9 103480168 missense probably benign 0.02
R0408:Bfsp2 UTSW 9 103480100 missense probably benign 0.06
R0463:Bfsp2 UTSW 9 103426655 missense possibly damaging 0.94
R1854:Bfsp2 UTSW 9 103449831 missense probably benign 0.01
R2139:Bfsp2 UTSW 9 103449875 missense probably benign 0.19
R2187:Bfsp2 UTSW 9 103426777 nonsense probably null
R3975:Bfsp2 UTSW 9 103480072 missense probably benign 0.00
R4823:Bfsp2 UTSW 9 103479883 missense probably damaging 1.00
R5035:Bfsp2 UTSW 9 103479866 missense probably benign 0.35
R5973:Bfsp2 UTSW 9 103432657 critical splice donor site probably null
R6005:Bfsp2 UTSW 9 103448550 missense probably damaging 0.99
R6106:Bfsp2 UTSW 9 103479824 missense probably benign 0.09
R6348:Bfsp2 UTSW 9 103480072 missense probably benign 0.17
R6364:Bfsp2 UTSW 9 103448628 missense probably damaging 0.98
R6701:Bfsp2 UTSW 9 103479878 missense possibly damaging 0.68
R6736:Bfsp2 UTSW 9 103480204 missense possibly damaging 0.60
R7129:Bfsp2 UTSW 9 103479919 missense probably damaging 0.99
R7204:Bfsp2 UTSW 9 103432666 missense probably damaging 0.99
R7329:Bfsp2 UTSW 9 103449922 missense probably benign 0.01
R7453:Bfsp2 UTSW 9 103453107 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTAGAAAGACACTGCTGATGCCC -3'
(R):5'- AGCTCAATGAATGCCCGAAGCTC -3'

Sequencing Primer
(F):5'- GGTGCGACTCCTACATAGAC -3'
(R):5'- TGCCCGAAGCTCATGGAAG -3'
Posted On2014-03-14