Incidental Mutation 'R1454:Cenpc1'
Institutional Source Beutler Lab
Gene Symbol Cenpc1
Ensembl Gene ENSMUSG00000029253
Gene Namecentromere protein C1
MMRRC Submission 039509-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1454 (G1)
Quality Score225
Status Validated
Chromosomal Location86012024-86065583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86013510 bp
Amino Acid Change Valine to Isoleucine at position 854 (V854I)
Ref Sequence ENSEMBL: ENSMUSP00000031170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031170]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031170
AA Change: V854I

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031170
Gene: ENSMUSG00000029253
AA Change: V854I

Pfam:CENP_C_N 7 121 6.1e-42 PFAM
Pfam:CENP_C_N 115 261 2.6e-46 PFAM
Pfam:CENP-C_mid 265 519 5.4e-100 PFAM
PDB:4INM|W 700 724 5e-9 PDB
Pfam:CENP-C_C 819 903 3.9e-28 PFAM
Meta Mutation Damage Score 0.1078 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: This gene encodes a centromeric protein component of a nucleosome-associated complex that plays a central role in kinetochore protein assembly, mitotic progression and chromosome segregation. The human ortholog encodes a protein with DNA-binding activity, that associates constitutively to kinetochores throughout the cell cycle, as part of a prekinetochore complex, together with centromeric protein-A and centromeric protein-B. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous mutation of this gene results in early embryonic lethality and mitotic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,869,993 V537A possibly damaging Het
Adcy10 A T 1: 165,515,380 I272F possibly damaging Het
Adcy6 A G 15: 98,604,728 S2P probably damaging Het
Agap1 A G 1: 89,837,806 probably null Het
Aldh3a2 A G 11: 61,265,102 V116A probably benign Het
Ankdd1b A T 13: 96,433,405 probably null Het
Antxrl G A 14: 34,060,949 V233I probably damaging Het
Atp8b5 A G 4: 43,302,590 I38V probably benign Het
Atxn7l2 A G 3: 108,208,432 probably benign Het
Bfsp2 A T 9: 103,480,225 M1K probably null Het
Camsap3 T A 8: 3,603,968 I520N possibly damaging Het
Csnk2a1 T C 2: 152,257,427 L88S probably damaging Het
Dcaf17 A G 2: 71,073,173 N171D probably damaging Het
Dctn1 G C 6: 83,197,508 A1077P possibly damaging Het
Dock1 T C 7: 134,851,609 probably benign Het
Egfr A T 11: 16,889,920 I645L probably benign Het
Gdpd1 T G 11: 87,059,509 K79N possibly damaging Het
Ggt5 A T 10: 75,609,908 L432F probably benign Het
Gm11060 A G 2: 105,093,752 T22A unknown Het
Gpr132 G A 12: 112,852,240 T322I possibly damaging Het
Grin1 G A 2: 25,292,430 R940* probably null Het
Hip1 T C 5: 135,438,632 T316A probably benign Het
Hnrnpm A G 17: 33,666,488 probably benign Het
Hsd3b5 G A 3: 98,619,530 T200I probably benign Het
Hspa9 A T 18: 34,938,606 L647H probably damaging Het
Itgad T C 7: 128,192,137 I727T probably benign Het
Kcnma1 T C 14: 23,463,200 D522G probably damaging Het
Lipf C T 19: 33,970,732 probably benign Het
Ly6i T C 15: 74,983,055 D2G possibly damaging Het
Mast1 G A 8: 84,920,635 P631L probably damaging Het
Mmp1b G C 9: 7,386,693 L144V probably damaging Het
Msh6 A G 17: 87,984,758 S314G probably benign Het
Myo5c G A 9: 75,263,066 V493I possibly damaging Het
Nefm A G 14: 68,121,379 L402P probably damaging Het
Nrxn2 T C 19: 6,481,446 F697S probably damaging Het
Olfr156 A T 4: 43,820,639 C241S probably damaging Het
Pex13 A G 11: 23,649,422 I363T probably benign Het
Plcb3 T C 19: 6,955,046 R1082G possibly damaging Het
Psg28 A T 7: 18,427,964 S205T possibly damaging Het
Pxt1 C A 17: 28,934,782 V26L possibly damaging Het
Ripk2 G A 4: 16,163,239 T53M probably damaging Het
Slc5a9 A G 4: 111,883,964 V495A probably benign Het
Snrpa T C 7: 27,192,937 K66R probably benign Het
Srgap1 T A 10: 121,896,738 E145V probably damaging Het
Suz12 A G 11: 80,032,113 T694A probably benign Het
Tatdn2 T A 6: 113,704,327 D440E probably benign Het
Tbc1d21 A G 9: 58,362,813 probably null Het
Tbc1d31 T A 15: 57,951,638 Y570* probably null Het
Tbc1d32 A T 10: 56,177,479 probably benign Het
Tdrd5 G C 1: 156,259,836 Q839E probably benign Het
Tecpr2 A G 12: 110,968,953 N1402S probably benign Het
Thbs1 A G 2: 118,122,672 D921G probably damaging Het
Tll1 A G 8: 64,038,490 V803A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm4 T C 7: 45,317,056 E461G probably damaging Het
Zp3 T A 5: 135,984,188 I152N probably damaging Het
Other mutations in Cenpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Cenpc1 APN 5 86037528 missense probably benign 0.02
IGL01287:Cenpc1 APN 5 86022454 nonsense probably null
IGL01363:Cenpc1 APN 5 86046531 nonsense probably null
IGL01720:Cenpc1 APN 5 86045425 missense possibly damaging 0.84
IGL02217:Cenpc1 APN 5 86029200 splice site probably benign
IGL02665:Cenpc1 APN 5 86046403 missense probably benign 0.01
IGL03022:Cenpc1 APN 5 86022375 splice site probably benign
IGL03162:Cenpc1 APN 5 86037905 missense possibly damaging 0.94
IGL03343:Cenpc1 APN 5 86016322 missense probably damaging 0.96
R0130:Cenpc1 UTSW 5 86046546 missense probably benign 0.07
R0193:Cenpc1 UTSW 5 86032403 missense probably benign 0.30
R0314:Cenpc1 UTSW 5 86037371 missense probably benign 0.20
R0932:Cenpc1 UTSW 5 86037600 missense possibly damaging 0.94
R0973:Cenpc1 UTSW 5 86037908 missense probably damaging 1.00
R0973:Cenpc1 UTSW 5 86037908 missense probably damaging 1.00
R0974:Cenpc1 UTSW 5 86037908 missense probably damaging 1.00
R1240:Cenpc1 UTSW 5 86035510 missense probably benign 0.32
R1677:Cenpc1 UTSW 5 86061998 splice site probably benign
R2044:Cenpc1 UTSW 5 86037755 missense probably benign 0.01
R2256:Cenpc1 UTSW 5 86016203 missense probably damaging 1.00
R3085:Cenpc1 UTSW 5 86037617 missense probably benign 0.01
R4516:Cenpc1 UTSW 5 86047587 missense possibly damaging 0.72
R4518:Cenpc1 UTSW 5 86047587 missense possibly damaging 0.72
R4561:Cenpc1 UTSW 5 86047632 missense probably damaging 1.00
R4827:Cenpc1 UTSW 5 86034431 missense possibly damaging 0.67
R4864:Cenpc1 UTSW 5 86045321 missense probably damaging 1.00
R5222:Cenpc1 UTSW 5 86037747 missense possibly damaging 0.77
R5707:Cenpc1 UTSW 5 86035434 missense possibly damaging 0.82
R5920:Cenpc1 UTSW 5 86020910 missense probably benign 0.00
R5999:Cenpc1 UTSW 5 86012263 missense probably damaging 1.00
R6073:Cenpc1 UTSW 5 86058153 critical splice donor site probably null
R6209:Cenpc1 UTSW 5 86033650 missense probably benign 0.02
R6244:Cenpc1 UTSW 5 86046385 missense probably damaging 1.00
R6278:Cenpc1 UTSW 5 86035535 missense probably damaging 0.97
R6395:Cenpc1 UTSW 5 86035570 missense probably benign 0.14
R7269:Cenpc1 UTSW 5 86013507 missense probably damaging 1.00
R7269:Cenpc1 UTSW 5 86032418 missense probably benign 0.12
R7335:Cenpc1 UTSW 5 86034353 missense possibly damaging 0.95
R7378:Cenpc1 UTSW 5 86046499 missense probably benign 0.02
RF018:Cenpc1 UTSW 5 86045369 missense possibly damaging 0.94
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- acccactctcttttcctccc -3'
Posted On2014-03-14