Incidental Mutation 'R1146:Prss16'
ID 165128
Institutional Source Beutler Lab
Gene Symbol Prss16
Ensembl Gene ENSMUSG00000006179
Gene Name protease, serine 16 (thymus)
Synonyms TSSP
MMRRC Submission 039219-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1146 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 22002173-22009742 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) A to G at 22006968 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006341] [ENSMUST00000150547]
AlphaFold Q9QXE5
Predicted Effect probably benign
Transcript: ENSMUST00000006341
SMART Domains Protein: ENSMUSP00000006341
Gene: ENSMUSG00000006179

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 40 53 N/A INTRINSIC
Pfam:Peptidase_S28 63 493 1.9e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130585
Predicted Effect probably benign
Transcript: ENSMUST00000150547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223857
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.5%
  • 10x: 95.4%
  • 20x: 88.7%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine protease expressed exclusively in the thymus. It is thought to play a role in the alternative antigen presenting pathway used by cortical thymic epithelial cells during the positive selection of T cells. The gene is found in the large histone gene cluster on chromosome 6, near the major histocompatibility complex (MHC) class I region. A second transcript variant has been described, but its full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable with no gross abnormalities and normal T cell development and activation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,531,676 V1848E probably damaging Het
Alpk3 A G 7: 81,077,595 K158E probably damaging Het
Arrdc4 T A 7: 68,740,008 E356D probably damaging Het
Asb4 A G 6: 5,423,591 N246S probably damaging Het
Ccdc150 A T 1: 54,364,971 probably benign Het
Ctsj G A 13: 61,002,498 P230L probably benign Het
Dync1i2 C T 2: 71,227,820 probably benign Het
Eme1 A G 11: 94,645,451 L564P probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Frg1 A G 8: 41,411,217 probably benign Het
Fzd2 A T 11: 102,605,380 S217C possibly damaging Het
Gaa G T 11: 119,274,904 R81L probably damaging Het
Gfral A G 9: 76,167,059 V368A probably benign Het
Gm10774 T C 2: 126,709,472 Y29C probably benign Het
Gucy1a2 T A 9: 3,759,830 N545K probably damaging Het
Herc2 T C 7: 56,146,696 S1939P probably benign Het
Ifnk T C 4: 35,152,231 I53T probably benign Het
Iqub G A 6: 24,505,628 L94F possibly damaging Het
Kpna1 C T 16: 36,033,379 R460* probably null Het
Masp1 T C 16: 23,492,115 E189G probably damaging Het
Mogat1 A G 1: 78,523,613 I105V probably benign Het
Mpi A G 9: 57,545,189 probably benign Het
Msh2 C A 17: 87,680,060 D209E probably benign Het
Nsf G A 11: 103,828,538 T646I probably damaging Het
Olfr1257 C T 2: 89,881,206 P127S probably damaging Het
Olfr1416 G A 1: 92,479,890 H244Y probably damaging Het
Olfr1449 T A 19: 12,934,965 S76T possibly damaging Het
Olfr980 A T 9: 40,006,094 V285D possibly damaging Het
Otogl T A 10: 107,886,513 I327F probably damaging Het
Pappa2 T C 1: 158,854,982 D832G probably damaging Het
Pax5 G T 4: 44,697,512 probably benign Het
Pfkfb4 A G 9: 109,007,726 E163G probably benign Het
Phc1 T C 6: 122,323,457 probably benign Het
Piwil1 T C 5: 128,747,893 S552P probably benign Het
Ppfia3 A C 7: 45,352,215 D424E probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbsn A G 6: 92,201,730 probably null Het
Rexo1 C T 10: 80,544,405 S919N probably benign Het
Sec31a T C 5: 100,362,173 N1152D probably damaging Het
Sel1l3 A T 5: 53,117,103 F1012I possibly damaging Het
Sema4c A G 1: 36,550,565 V539A probably benign Het
Sf3b5 A G 10: 13,008,831 E70G possibly damaging Het
Tmcc2 TTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGC 1: 132,357,755 probably benign Het
Tor1aip2 T C 1: 156,064,737 V263A possibly damaging Het
Unc45b A G 11: 82,922,907 E380G probably damaging Het
Usp16 C T 16: 87,474,648 T364M possibly damaging Het
Wwox T C 8: 114,712,036 S281P probably damaging Het
Zfp110 A G 7: 12,846,794 probably null Het
Zfp335 G A 2: 164,896,123 A856V probably benign Het
Zfp652 G A 11: 95,749,782 E178K possibly damaging Het
Other mutations in Prss16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02025:Prss16 APN 13 22003021 missense probably damaging 0.99
IGL02272:Prss16 APN 13 22003035 missense probably damaging 0.96
IGL02383:Prss16 APN 13 22009527 missense probably benign 0.00
IGL02892:Prss16 APN 13 22003050 missense probably benign 0.03
IGL03325:Prss16 APN 13 22003247 missense possibly damaging 0.90
BB001:Prss16 UTSW 13 22008664 missense probably damaging 0.99
BB011:Prss16 UTSW 13 22008664 missense probably damaging 0.99
R0645:Prss16 UTSW 13 22009376 unclassified probably benign
R0970:Prss16 UTSW 13 22005117 missense probably damaging 1.00
R1292:Prss16 UTSW 13 22009521 nonsense probably null
R1371:Prss16 UTSW 13 22008686 unclassified probably benign
R1525:Prss16 UTSW 13 22009443 missense possibly damaging 0.50
R1624:Prss16 UTSW 13 22003313 missense probably benign 0.31
R2233:Prss16 UTSW 13 22009409 missense possibly damaging 0.70
R5147:Prss16 UTSW 13 22006094 missense possibly damaging 0.70
R5670:Prss16 UTSW 13 22003051 missense possibly damaging 0.74
R6440:Prss16 UTSW 13 22003160 missense probably damaging 0.97
R6668:Prss16 UTSW 13 22006748 missense probably null 0.01
R6791:Prss16 UTSW 13 22006067 missense probably damaging 0.99
R7278:Prss16 UTSW 13 22003147 missense probably damaging 1.00
R7924:Prss16 UTSW 13 22008664 missense probably damaging 0.99
R8865:Prss16 UTSW 13 22003005 missense possibly damaging 0.71
R8980:Prss16 UTSW 13 22003042 missense probably benign 0.13
R9139:Prss16 UTSW 13 22008343 missense probably damaging 1.00
R9211:Prss16 UTSW 13 22008584 missense probably benign 0.19
R9276:Prss16 UTSW 13 22006005 start gained probably benign
R9318:Prss16 UTSW 13 22006938 missense possibly damaging 0.95
R9748:Prss16 UTSW 13 22008334 missense possibly damaging 0.88
Z1176:Prss16 UTSW 13 22006054 nonsense probably null
Z1176:Prss16 UTSW 13 22006400 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TTGCAAAACCAGACTGCGTCCC -3'
(R):5'- GCTGAAGGTCCTCAGAATTCCTCG -3'

Sequencing Primer
(F):5'- AATGATCCTCCTATGGCGAC -3'
(R):5'- CTCAGAATTCCTCGGGTGG -3'
Posted On 2014-03-28