Mutagenetix > Incidental Mutations

Incidental Mutation 'R1522:Itga5'

167568

Institutional Source

Beutler Lab

Gene Symbol

Itga5

Ensembl Gene

ENSMUSG00000000555

Gene Name

integrin alpha 5 (fibronectin receptor alpha)

Synonyms

Fnra, Cd49e

MMRRC Submission

040871-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1522 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

103344286-103366763 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 103356782 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 233 (Q233*)

Ref Sequence

ENSEMBL: ENSMUSP00000023128 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023128] [ENSMUST00000023128] [ENSMUST00000215331]

Predicted Effect

probably null
Transcript: ENSMUST00000023128
AA Change: Q233*

SMART Domains

Protein: ENSMUSP00000023128
Gene: ENSMUSG00000000555
AA Change: Q233*

Domain	Start	End	E-Value	Type
low complexity region	17	40	N/A	INTRINSIC
Int_alpha	59	118	2.27e-8	SMART
Int_alpha	271	321	9.6e-7	SMART
Int_alpha	325	387	1.03e-15	SMART
Int_alpha	391	447	4.17e-16	SMART
Int_alpha	455	511	1.49e-3	SMART
SCOP:d1m1xa2	651	789	3e-44	SMART
SCOP:d1m1xa3	792	992	1e-62	SMART
transmembrane domain	1003	1025	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000023128
AA Change: Q233*

SMART Domains

Protein: ENSMUSP00000023128
Gene: ENSMUSG00000000555
AA Change: Q233*

Domain	Start	End	E-Value	Type
low complexity region	17	40	N/A	INTRINSIC
Int_alpha	59	118	2.27e-8	SMART
Int_alpha	271	321	9.6e-7	SMART
Int_alpha	325	387	1.03e-15	SMART
Int_alpha	391	447	4.17e-16	SMART
Int_alpha	455	511	1.49e-3	SMART
SCOP:d1m1xa2	651	789	3e-44	SMART
SCOP:d1m1xa3	792	992	1e-62	SMART
transmembrane domain	1003	1025	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000215331

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230460

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 91.1%

Validation Efficiency

MGI Phenotype

FUNCTION: The product of this gene belongs to the integrin alpha chain family. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes the integrin alpha 5 chain, which is proteolytically processed to generate light and heavy chains that join with beta 1 to form a fibronectin receptor. In addition to adhesion, integrins are known to participate in cell-surface mediated signaling. Integrin alpha 5 and integrin alpha V chains are produced by distinct genes. Homozygous knockout mice for this gene exhibit embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in posterior trunk and yolk sac mesodermal structures, lack of epithelialization of somites, reduced numbers of Schwann cells, and lethality around embryonic day 10-11. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	T	C	6: 83,162,586	S498P	probably damaging	Het
3100002H09Rik	A	G	4: 124,610,694	W22R	probably damaging	Het
AA986860	A	G	1: 130,743,094	E351G	probably damaging	Het
Acsl5	T	C	19: 55,280,492	V195A	probably benign	Het
Adamts10	A	G	17: 33,537,319	D312G	probably benign	Het
Adgrb1	A	G	15: 74,580,617	M211V	probably damaging	Het
Ankfy1	C	T	11: 72,755,867	R859*	probably null	Het
Atp8b1	T	A	18: 64,550,432	I742L	probably benign	Het
B3galnt2	T	A	13: 13,970,769	V89E	probably damaging	Het
BC024978	A	G	7: 27,202,680	H244R	probably damaging	Het
Brinp3	A	C	1: 146,901,890	T692P	probably damaging	Het
C9	T	A	15: 6,486,762	F349I	probably damaging	Het
Cacna1a	T	A	8: 84,633,433	M1976K	probably benign	Het
Ccdc180	T	C	4: 45,927,975	V1170A	possibly damaging	Het
Celsr1	A	G	15: 85,931,276	V1846A	probably benign	Het
Ces1f	A	T	8: 93,271,889	Y160N	possibly damaging	Het
Cfap45	A	G	1: 172,540,572	E377G	probably damaging	Het
Clca3a1	T	A	3: 144,755,171	M240L	probably benign	Het
Clnk	G	A	5: 38,794,966	T10M	probably damaging	Het
Cntrl	T	A	2: 35,155,279	I781K	possibly damaging	Het
Col11a2	G	A	17: 34,055,254	G375S	probably damaging	Het
Col6a5	T	A	9: 105,939,994	I373F	unknown	Het
Dmxl1	C	T	18: 49,852,367	A227V	probably benign	Het
Dok5	A	G	2: 170,732,132	N4D	probably benign	Het
Dpysl3	A	T	18: 43,363,557	V138D	probably damaging	Het
Efs	A	T	14: 54,919,715	Y380N	probably damaging	Het
Eme2	G	A	17: 24,892,918	S263F	probably damaging	Het
Farp2	A	G	1: 93,618,553	Q855R	possibly damaging	Het
Fcrls	A	C	3: 87,256,707	S372A	possibly damaging	Het
Gadl1	C	T	9: 115,944,229	A113V	probably damaging	Het
Gatsl2	T	G	5: 134,125,887	S43R	probably damaging	Het
Gda	T	A	19: 21,412,539	E219D	probably benign	Het
Gli1	A	T	10: 127,332,577	M469K	probably damaging	Het
Gm4847	A	T	1: 166,641,650	S148R	probably damaging	Het
Golga2	T	C	2: 32,302,204	V325A	probably benign	Het
Hpf1	A	G	8: 60,896,749	D137G	probably damaging	Het
Htr2a	C	G	14: 74,705,853	S291*	probably null	Het
Jazf1	C	A	6: 52,812,183	R102L	probably damaging	Het
Kif6	T	G	17: 49,714,113	L322R	probably damaging	Het
Ktn1	A	C	14: 47,667,416	K217T	probably damaging	Het
Lig4	A	T	8: 9,973,012	V256E	possibly damaging	Het
Lrp1	G	T	10: 127,567,364	D2113E	probably damaging	Het
Lrp1	A	T	10: 127,575,286	D1399E	probably benign	Het
Mmel1	A	G	4: 154,894,986	E717G	probably damaging	Het
Mndal	G	T	1: 173,871,466	P155H	possibly damaging	Het
Mycbpap	A	G	11: 94,511,623		probably null	Het
Nedd1	T	C	10: 92,719,614	E3G	probably damaging	Het
Nlgn1	A	T	3: 25,435,909	N551K	probably damaging	Het
Nup210	G	A	6: 91,069,166	P595L	possibly damaging	Het
Olfr117	A	T	17: 37,659,770	C188S	probably damaging	Het
Olfr1302	A	T	2: 111,780,348		probably null	Het
Olfr199	T	G	16: 59,215,984	T210P	probably damaging	Het
Olfr477	A	G	7: 107,990,533	H56R	probably benign	Het
Olfr697	A	G	7: 106,741,005	C310R	probably benign	Het
Pank3	G	A	11: 35,781,681	V304M	probably benign	Het
Phf3	G	A	1: 30,805,648	T1410I	probably benign	Het
Ppm1k	A	G	6: 57,525,157	I7T	possibly damaging	Het
Ppp1r12c	T	C	7: 4,497,425	D73G	probably damaging	Het
Prelid2	T	G	18: 41,881,267	M165L	probably benign	Het
Prkd3	A	C	17: 78,952,696	L826R	probably damaging	Het
Ptchd4	A	T	17: 42,503,542	N778I	probably damaging	Het
Ptprm	T	C	17: 66,693,871	D1063G	possibly damaging	Het
Rab27a	C	A	9: 73,075,482	T23N	probably damaging	Het
Rasgrf2	A	T	13: 91,896,086	F949L	probably benign	Het
Rbm33	A	G	5: 28,337,004	N68D	probably damaging	Het
Rgl1	A	T	1: 152,586,533	L109Q	probably damaging	Het
Rnf20	A	G	4: 49,638,197	N103S	possibly damaging	Het
Sbno1	G	A	5: 124,392,612	L875F	probably damaging	Het
Scube1	T	A	15: 83,628,076		probably null	Het
Selenbp1	G	A	3: 94,937,358	V109M	probably damaging	Het
Serpina3c	T	A	12: 104,151,546	I178F	probably damaging	Het
Shisa8	C	T	15: 82,208,501	G63D	probably damaging	Het
Snx14	T	C	9: 88,402,224	R464G	possibly damaging	Het
Snx25	A	T	8: 46,124,082	M1K	probably null	Het
Sorcs3	C	A	19: 48,706,009	T574K	possibly damaging	Het
Syne2	A	G	12: 76,103,783	E6528G	probably damaging	Het
Syt5	T	C	7: 4,540,246	E338G	probably damaging	Het
Tbk1	T	C	10: 121,551,318	K691E	probably benign	Het
Tenm3	G	A	8: 48,395,576	T11I	probably damaging	Het
Thrb	A	G	14: 18,002,597	H87R	probably damaging	Het
Tlr4	T	A	4: 66,839,696	M242K	possibly damaging	Het
Tm4sf19	T	C	16: 32,406,002	M56T	possibly damaging	Het
Tmem212	T	A	3: 27,886,471	R66*	probably null	Het
Tmem39b	G	T	4: 129,684,482	D315E	probably benign	Het
Tnxb	T	C	17: 34,718,638	F3834L	probably damaging	Het
Trim36	A	T	18: 46,186,183	L225*	probably null	Het
Trim42	A	T	9: 97,365,679	H321Q	probably damaging	Het
Trio	G	T	15: 27,732,640	Q3052K	probably benign	Het
Trpm3	T	C	19: 22,978,334	I1091T	probably benign	Het
Tst	T	C	15: 78,399,943	E228G	possibly damaging	Het
Ttn	T	C	2: 76,871,716		probably benign	Het
Uap1	A	C	1: 170,150,941		probably null	Het
Ush2a	T	C	1: 188,797,814	S3267P	possibly damaging	Het
Usp5	T	C	6: 124,825,166	T38A	probably benign	Het
Uvssa	A	T	5: 33,387,808	Q84L	probably damaging	Het
Vmn1r159	T	G	7: 22,843,268	H113P	probably damaging	Het
Vps13d	A	T	4: 145,098,172		probably null	Het
Zfp182	T	A	X: 21,031,560	I166L	probably benign	Het
Zfp811	A	T	17: 32,797,648	Y472N	probably damaging	Het

Other mutations in Itga5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00914:Itga5	APN	15	103350372	critical splice donor site	probably null
IGL01102:Itga5	APN	15	103346675	missense	probably benign	0.13
IGL01474:Itga5	APN	15	103354270	nonsense	probably null
IGL01768:Itga5	APN	15	103351570	missense	probably benign	0.34
IGL01832:Itga5	APN	15	103355949	nonsense	probably null
IGL02188:Itga5	APN	15	103347717	missense	probably benign	0.30
IGL02701:Itga5	APN	15	103347766	missense	probably damaging	0.98
IGL02838:Itga5	APN	15	103351609	missense	probably damaging	1.00
IGL02955:Itga5	APN	15	103350834	missense	possibly damaging	0.48
R0617:Itga5	UTSW	15	103356315	critical splice donor site	probably null
R0845:Itga5	UTSW	15	103350769	missense	probably benign	0.07
R1210:Itga5	UTSW	15	103357473	missense	possibly damaging	0.76
R1576:Itga5	UTSW	15	103351617	missense	probably damaging	0.96
R1666:Itga5	UTSW	15	103347902	missense	probably benign	0.00
R1808:Itga5	UTSW	15	103350399	missense	probably damaging	1.00
R1836:Itga5	UTSW	15	103346014	missense	probably damaging	1.00
R1964:Itga5	UTSW	15	103354314	missense	probably damaging	1.00
R4290:Itga5	UTSW	15	103352257	critical splice donor site	probably null
R4458:Itga5	UTSW	15	103350203	missense	probably damaging	1.00
R4610:Itga5	UTSW	15	103350832	missense	probably damaging	1.00
R4676:Itga5	UTSW	15	103357210	missense	probably damaging	1.00
R4795:Itga5	UTSW	15	103347760	missense	probably benign	0.05
R4796:Itga5	UTSW	15	103347760	missense	probably benign	0.05
R4837:Itga5	UTSW	15	103354084	missense	probably damaging	0.99
R4929:Itga5	UTSW	15	103353235	missense	probably benign	0.42
R5896:Itga5	UTSW	15	103351087	missense	probably benign
R5947:Itga5	UTSW	15	103356785	missense	probably damaging	1.00
R5957:Itga5	UTSW	15	103351429	missense	probably benign	0.05
R6153:Itga5	UTSW	15	103357453	missense	probably damaging	1.00
R6353:Itga5	UTSW	15	103352523	missense	probably damaging	0.98
R6657:Itga5	UTSW	15	103350795	missense	probably damaging	1.00
R6698:Itga5	UTSW	15	103351381	missense	probably benign	0.15
R6891:Itga5	UTSW	15	103357543	missense	probably damaging	1.00
R6981:Itga5	UTSW	15	103350226	missense	probably benign	0.00
R7574:Itga5	UTSW	15	103350449	missense	probably damaging	1.00
R7762:Itga5	UTSW	15	103349757	missense	probably benign	0.01
R7813:Itga5	UTSW	15	103357314	critical splice acceptor site	probably null
R7984:Itga5	UTSW	15	103355952	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTACACAAGTATGGCAGCAGAGC -3'
(R):5'- CACAGATTTTGGCAGTGCAGCAG -3'

Sequencing Primer
(F):5'- gagaggcagaggcaagag -3'
(R):5'- GGCAGGGCTACTGCCAAG -3'

Posted On

2014-04-13