Mutagenetix > Incidental Mutation

Incidental Mutation 'R7762:Itga5'

597974

Institutional Source

Beutler Lab

Gene Symbol

Itga5

Ensembl Gene

ENSMUSG00000000555

Gene Name

integrin alpha 5 (fibronectin receptor alpha)

Synonyms

Fnra, Cd49e

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7762 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103344286-103366763 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 103349757 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 837 (N837S)

Ref Sequence

ENSEMBL: ENSMUSP00000023128 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023128] [ENSMUST00000215331]

AlphaFold

P11688

Predicted Effect

probably benign
Transcript: ENSMUST00000023128
AA Change: N837S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000023128
Gene: ENSMUSG00000000555
AA Change: N837S

Domain	Start	End	E-Value	Type
low complexity region	17	40	N/A	INTRINSIC
Int_alpha	59	118	2.27e-8	SMART
Int_alpha	271	321	9.6e-7	SMART
Int_alpha	325	387	1.03e-15	SMART
Int_alpha	391	447	4.17e-16	SMART
Int_alpha	455	511	1.49e-3	SMART
SCOP:d1m1xa2	651	789	3e-44	SMART
SCOP:d1m1xa3	792	992	1e-62	SMART
transmembrane domain	1003	1025	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000215331

Meta Mutation Damage Score

0.6480

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: The product of this gene belongs to the integrin alpha chain family. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes the integrin alpha 5 chain, which is proteolytically processed to generate light and heavy chains that join with beta 1 to form a fibronectin receptor. In addition to adhesion, integrins are known to participate in cell-surface mediated signaling. Integrin alpha 5 and integrin alpha V chains are produced by distinct genes. Homozygous knockout mice for this gene exhibit embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in posterior trunk and yolk sac mesodermal structures, lack of epithelialization of somites, reduced numbers of Schwann cells, and lethality around embryonic day 10-11. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	G	A	6: 48,932,686	V622I	probably benign	Het
9130011E15Rik	A	G	19: 45,940,443		probably null	Het
Acod1	T	G	14: 103,051,340	D95E	probably damaging	Het
Agpat4	A	G	17: 12,210,322	T154A	possibly damaging	Het
Ahnak2	A	T	12: 112,775,680	S653T	probably benign	Het
Aox2	C	T	1: 58,349,104	P1124S	probably damaging	Het
Atp4a	T	C	7: 30,720,036	I637T	probably damaging	Het
Atxn7	T	A	14: 14,100,467	C718S	probably damaging	Het
Btbd2	T	A	10: 80,643,556	I516F	probably damaging	Het
Card6	A	G	15: 5,105,338	S128P	probably benign	Het
Cat	T	C	2: 103,456,858	K476E	probably benign	Het
Ccr9	A	T	9: 123,779,957	T235S	probably benign	Het
Cep55	T	G	19: 38,069,069		probably null	Het
Clec2e	A	G	6: 129,095,128	F96S	possibly damaging	Het
Clk2	G	A	3: 89,167,191	V53I	probably benign	Het
Clnk	T	C	5: 38,768,141	M106V	probably benign	Het
Col6a5	T	C	9: 105,931,324	I842V	unknown	Het
Csf1r	A	T	18: 61,110,500	N196I	probably benign	Het
D5Ertd579e	A	T	5: 36,613,381	N116K		Het
Dnaja4	A	G	9: 54,709,210	I166V	probably benign	Het
Dqx1	A	G	6: 83,061,032	E467G	probably damaging	Het
Dync2h1	T	C	9: 7,129,719	T1760A	probably benign	Het
Eea1	T	C	10: 96,028,439	V940A	probably benign	Het
Egr1	T	A	18: 34,863,545	V460E	probably damaging	Het
Eral1	A	G	11: 78,074,533	I352T	possibly damaging	Het
F2	T	C	2: 91,628,696	H476R	possibly damaging	Het
Fam83b	A	G	9: 76,492,432	V463A	possibly damaging	Het
Fat1	T	C	8: 45,023,322	S1802P	probably damaging	Het
Fat1	T	A	8: 45,037,337	L3762H	probably damaging	Het
Fibp	A	T	19: 5,464,174	N296Y	probably benign	Het
Figla	A	G	6: 86,017,326	M28V	probably benign	Het
Foxd3	C	A	4: 99,657,125	Y167*	probably null	Het
Gm17019	T	A	5: 15,030,992	H145L	probably benign	Het
Gm340	T	C	19: 41,583,667	L287S	probably benign	Het
Gm48552	C	T	10: 81,390,435	P18L	probably damaging	Het
Gm9573	G	A	17: 35,622,085	T403I	unknown	Het
H2-Q6	A	G	17: 35,428,101	N283S	probably benign	Het
Hrh2	T	A	13: 54,214,039	C11*	probably null	Het
Hrnr	G	T	3: 93,332,199	G3248V	unknown	Het
Iapp	C	A	6: 142,303,396	N58K	possibly damaging	Het
Klhl35	C	A	7: 99,468,440	H64N	probably benign	Het
Lrba	T	A	3: 86,532,201	V2015E	probably damaging	Het
Mdn1	T	C	4: 32,734,421	I3276T	probably benign	Het
Mlh3	G	T	12: 85,268,284	T376K	possibly damaging	Het
Nbea	A	T	3: 55,649,705	H2550Q	probably damaging	Het
Nid1	G	A	13: 13,489,045	G763D	probably damaging	Het
Ntf5	C	A	7: 45,415,819	A125E	probably damaging	Het
Obsl1	A	T	1: 75,503,523	C460S	probably benign	Het
Olfr1272	T	A	2: 90,296,631	K77*	probably null	Het
Olfr130	G	A	17: 38,067,675	C168Y	probably damaging	Het
Olfr1380	T	A	11: 49,564,761	I280N	possibly damaging	Het
Olfr1496	A	T	19: 13,781,286	R223W	probably damaging	Het
Olfr348	A	T	2: 36,787,010	I162F	probably benign	Het
Olfr820	A	G	10: 130,017,181		probably benign	Het
Olfr933	G	A	9: 38,976,194	V173I	probably benign	Het
Orai3	G	A	7: 127,773,571	G130S	unknown	Het
Pcdhb12	T	G	18: 37,435,924	V41G	probably damaging	Het
Plec	A	T	15: 76,183,623	L1194Q	unknown	Het
Pml	C	A	9: 58,220,173	C763F	probably damaging	Het
Prdm15	T	A	16: 97,818,273	I318F	probably benign	Het
Rcbtb2	C	A	14: 73,178,466	T473N	probably benign	Het
Sbno1	T	A	5: 124,374,666	I1347F	probably benign	Het
Secisbp2l	C	T	2: 125,768,193	D269N	probably damaging	Het
Serpina9	A	T	12: 104,001,316	F273L	probably damaging	Het
Sgms2	T	A	3: 131,323,249	Y319F	probably benign	Het
Sgo2b	A	T	8: 63,926,497	H1100Q	probably benign	Het
Sh3bp5l	A	T	11: 58,345,928		probably null	Het
Shh	T	G	5: 28,466,666	K33T	probably benign	Het
Slc5a9	A	G	4: 111,890,174	Y339H	probably damaging	Het
Spice1	T	A	16: 44,370,501		probably null	Het
Tbx2	A	G	11: 85,835,901	E257G	probably damaging	Het
Tenm2	G	A	11: 36,023,306	T2468I	possibly damaging	Het
Tmeff2	A	T	1: 50,979,416	N186Y	probably benign	Het
Tmem132c	T	C	5: 127,554,696	V673A	possibly damaging	Het
Trappc11	G	T	8: 47,522,376	T269K	probably damaging	Het
Trpc6	T	C	9: 8,653,149	F652S	possibly damaging	Het
Trpv1	G	T	11: 73,254,222	K711N	probably benign	Het
Vcan	G	T	13: 89,692,937	P1496Q	probably damaging	Het
Vmn1r192	G	T	13: 22,187,675	A125E	probably damaging	Het
Vti1b	A	T	12: 79,164,946		probably null	Het
Vwa3b	A	C	1: 37,124,045	D583A	probably damaging	Het
Zfp638	T	C	6: 83,976,272	S1120P	probably damaging	Het
Zfyve26	A	T	12: 79,268,635	F1356I	probably benign	Het

Other mutations in Itga5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00914:Itga5	APN	15	103350372	critical splice donor site	probably null
IGL01102:Itga5	APN	15	103346675	missense	probably benign	0.13
IGL01474:Itga5	APN	15	103354270	nonsense	probably null
IGL01768:Itga5	APN	15	103351570	missense	probably benign	0.34
IGL01832:Itga5	APN	15	103355949	nonsense	probably null
IGL02188:Itga5	APN	15	103347717	missense	probably benign	0.30
IGL02701:Itga5	APN	15	103347766	missense	probably damaging	0.98
IGL02838:Itga5	APN	15	103351609	missense	probably damaging	1.00
IGL02955:Itga5	APN	15	103350834	missense	possibly damaging	0.48
R0617:Itga5	UTSW	15	103356315	critical splice donor site	probably null
R0845:Itga5	UTSW	15	103350769	missense	probably benign	0.07
R1210:Itga5	UTSW	15	103357473	missense	possibly damaging	0.76
R1522:Itga5	UTSW	15	103356782	nonsense	probably null
R1576:Itga5	UTSW	15	103351617	missense	probably damaging	0.96
R1666:Itga5	UTSW	15	103347902	missense	probably benign	0.00
R1808:Itga5	UTSW	15	103350399	missense	probably damaging	1.00
R1836:Itga5	UTSW	15	103346014	missense	probably damaging	1.00
R1964:Itga5	UTSW	15	103354314	missense	probably damaging	1.00
R4290:Itga5	UTSW	15	103352257	critical splice donor site	probably null
R4458:Itga5	UTSW	15	103350203	missense	probably damaging	1.00
R4610:Itga5	UTSW	15	103350832	missense	probably damaging	1.00
R4676:Itga5	UTSW	15	103357210	missense	probably damaging	1.00
R4795:Itga5	UTSW	15	103347760	missense	probably benign	0.05
R4796:Itga5	UTSW	15	103347760	missense	probably benign	0.05
R4837:Itga5	UTSW	15	103354084	missense	probably damaging	0.99
R4929:Itga5	UTSW	15	103353235	missense	probably benign	0.42
R5896:Itga5	UTSW	15	103351087	missense	probably benign
R5947:Itga5	UTSW	15	103356785	missense	probably damaging	1.00
R5957:Itga5	UTSW	15	103351429	missense	probably benign	0.05
R6153:Itga5	UTSW	15	103357453	missense	probably damaging	1.00
R6353:Itga5	UTSW	15	103352523	missense	probably damaging	0.98
R6657:Itga5	UTSW	15	103350795	missense	probably damaging	1.00
R6698:Itga5	UTSW	15	103351381	missense	probably benign	0.15
R6891:Itga5	UTSW	15	103357543	missense	probably damaging	1.00
R6981:Itga5	UTSW	15	103350226	missense	probably benign	0.00
R7574:Itga5	UTSW	15	103350449	missense	probably damaging	1.00
R7813:Itga5	UTSW	15	103357314	critical splice acceptor site	probably null
R7984:Itga5	UTSW	15	103355952	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTCCATAGTCCCATAGCC -3'
(R):5'- TGAGGATCTGTGAGAGATGTCCAG -3'

Sequencing Primer
(F):5'- TAGTCCCATAGCCCCACCG -3'
(R):5'- CATGGATTACAGAGTGAGACCTTGTC -3'

Posted On

2019-11-26