Mutagenetix > Incidental Mutations

Incidental Mutation 'R1715:Ccng1'

190948

Institutional Source

Beutler Lab

Gene Symbol

Ccng1

Ensembl Gene

ENSMUSG00000020326

Gene Name

cyclin G1

Synonyms

cyclin G

MMRRC Submission

039748-MU

Accession Numbers

Genbank: NM_009831

Is this an essential gene?

Possibly non essential (E-score: 0.270) question?

Stock #

R1715 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

40748552-40755311 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 40752114 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 169 (P169S)

Ref Sequence

ENSEMBL: ENSMUSP00000020576 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020576]

Predicted Effect

probably benign
Transcript: ENSMUST00000020576
AA Change: P169S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000020576
Gene: ENSMUSG00000020326
AA Change: P169S

Domain	Start	End	E-Value	Type
CYCLIN	56	142	3.63e-17	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151359

Meta Mutation Damage Score

0.0587

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The eukaryotic cell cycle is governed by cyclin-dependent protein kinases (CDKs) whose activities are regulated by cyclins and CDK inhibitors. The protein encoded by this gene is a member of the cyclin family and contains the cyclin box. The encoded protein lacks the protein destabilizing (PEST) sequence that is present in other family members. Transcriptional activation of this gene can be induced by tumor protein p53. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Depending on the allele, homozygous mutants exhibit increased cellular sensitivity to gamma-irradiation or decreased incidence of induced hepatic tumors. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted, knock-out(2) Targeted, other(1) Gene trapped(4)

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700023F06Rik	T	C	11: 103,199,824		probably null	Het
2210010C04Rik	A	G	6: 41,032,936		probably null	Het
2410089E03Rik	T	A	15: 8,226,900		probably null	Het
Abca8a	G	A	11: 110,091,580	T12M	probably damaging	Het
Alms1	T	A	6: 85,629,052	Y2561*	probably null	Het
Atp10a	G	A	7: 58,786,505	V348I	probably damaging	Het
Best2	T	C	8: 85,011,223	Y181C	probably benign	Het
Btaf1	T	A	19: 36,969,121	D442E	probably damaging	Het
C330027C09Rik	C	T	16: 49,005,719	T383I	probably benign	Het
Carmil3	T	G	14: 55,504,532	V1153G	probably benign	Het
Cc2d2a	A	G	5: 43,718,661	I993M	probably damaging	Het
Cmtr2	T	C	8: 110,222,798	L580P	probably damaging	Het
Col22a1	T	C	15: 72,006,981	E109G	possibly damaging	Het
Crispld2	G	T	8: 120,023,649	W264L	possibly damaging	Het
Cyp2c38	T	C	19: 39,404,795	H276R	probably benign	Het
Dag1	A	T	9: 108,208,715	V409E	possibly damaging	Het
Emc8	T	C	8: 120,658,555	N146S	probably benign	Het
Glt8d1	T	C	14: 31,011,521	V321A	possibly damaging	Het
Gm5174	C	T	10: 86,656,912		noncoding transcript	Het
Hdac10	G	T	15: 89,126,709		probably null	Het
Hectd4	A	G	5: 121,344,818	D3144G	possibly damaging	Het
Ifna11	C	T	4: 88,820,236	S93L	probably damaging	Het
Il16	T	C	7: 83,648,728	N431S	probably benign	Het
Irf8	A	T	8: 120,754,388	E237V	probably damaging	Het
Lrp1b	A	G	2: 41,185,981	Y1769H	probably damaging	Het
Lrrc9	A	G	12: 72,477,299	N761D	probably damaging	Het
Mbtps1	T	C	8: 119,542,730	Y207C	probably benign	Het
Myo9a	A	G	9: 59,832,300	E765G	probably damaging	Het
Nlrp3	A	G	11: 59,543,351	D80G	probably damaging	Het
Olfr361	G	A	2: 37,085,176	P191S	probably damaging	Het
Olfr697	G	C	7: 106,741,548	P129A	probably damaging	Het
Olfr830	A	T	9: 18,875,794	I156F	probably benign	Het
Pcyt2	T	A	11: 120,615,851		probably null	Het
Plxnd1	T	C	6: 115,968,681	T944A	probably benign	Het
Psd4	A	T	2: 24,405,332	I833F	probably damaging	Het
Psmd7	A	G	8: 107,581,185	I222T	probably benign	Het
Rap2b	A	G	3: 61,365,190	E45G	probably damaging	Het
Rbm22	T	C	18: 60,560,844	S7P	possibly damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Rfx4	A	G	10: 84,844,280	N107S	probably damaging	Het
Ripk2	T	A	4: 16,155,192		probably null	Het
Rpgrip1	T	A	14: 52,140,691	C499S	possibly damaging	Het
Scarf1	T	C	11: 75,524,044	S515P	probably damaging	Het
Sgip1	T	C	4: 102,915,059	V215A	probably benign	Het
Sis	T	C	3: 72,889,010	I1813V	possibly damaging	Het
Slc17a3	A	T	13: 23,856,741	T317S	probably benign	Het
Slc35e1	T	C	8: 72,483,977	N340S	probably benign	Het
Smg6	A	G	11: 74,929,430	I176V	probably benign	Het
Smim17	T	C	7: 6,429,326	L89S	probably damaging	Het
Synm	T	C	7: 67,736,303	N95S	probably damaging	Het
Tdrd9	A	G	12: 112,036,439	K841E	possibly damaging	Het
Tep1	G	T	14: 50,854,567	F570L	possibly damaging	Het
Tgm3	G	A	2: 130,026,814		probably null	Het
Tra2b	T	C	16: 22,252,746	Y128C	possibly damaging	Het
Vmn2r17	T	C	5: 109,428,244	V327A	probably benign	Het
Wdr20rt	A	T	12: 65,227,314	D344V	probably damaging	Het
Zfp940	A	G	7: 29,844,938	C515R	probably damaging	Het

Other mutations in Ccng1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00693:Ccng1	APN	11	40754058	missense	probably benign	0.00
IGL01875:Ccng1	APN	11	40752356	missense	probably benign	0.09
IGL02986:Ccng1	APN	11	40750863	utr 3 prime	probably benign
G5030:Ccng1	UTSW	11	40753802	splice site	probably benign
R1375:Ccng1	UTSW	11	40752114	missense	probably benign	0.02
R1377:Ccng1	UTSW	11	40752114	missense	probably benign	0.02
R3620:Ccng1	UTSW	11	40752165	missense	probably benign	0.01
R3857:Ccng1	UTSW	11	40753833	missense	probably damaging	0.99
R3858:Ccng1	UTSW	11	40753833	missense	probably damaging	0.99
R5082:Ccng1	UTSW	11	40752188	missense	possibly damaging	0.77
R5172:Ccng1	UTSW	11	40751286	missense	probably benign
R5521:Ccng1	UTSW	11	40752266	missense	possibly damaging	0.87
R7431:Ccng1	UTSW	11	40753918	missense	possibly damaging	0.74
R7961:Ccng1	UTSW	11	40751269	missense	probably benign	0.00
R8009:Ccng1	UTSW	11	40751269	missense	probably benign	0.00
T0975:Ccng1	UTSW	11	40754044	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGACTGGCAGGCATCTTTTCACTTC -3'
(R):5'- ACCCAAAGCCACTGGTTTCAAGTAG -3'

Sequencing Primer
(F):5'- CACTTCTGTTAGGCAGCAAAG -3'
(R):5'- GTGTCCTACTGAAGCACTGTAAAG -3'

Posted On

2014-05-14