Incidental Mutation 'R1715:Ccng1'
ID190948
Institutional Source Beutler Lab
Gene Symbol Ccng1
Ensembl Gene ENSMUSG00000020326
Gene Namecyclin G1
Synonymscyclin G
MMRRC Submission 039748-MU
Accession Numbers

Genbank: NM_009831

Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R1715 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location40748552-40755311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40752114 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 169 (P169S)
Ref Sequence ENSEMBL: ENSMUSP00000020576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020576]
Predicted Effect probably benign
Transcript: ENSMUST00000020576
AA Change: P169S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000020576
Gene: ENSMUSG00000020326
AA Change: P169S

DomainStartEndE-ValueType
CYCLIN 56 142 3.63e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151359
Meta Mutation Damage Score 0.0587 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The eukaryotic cell cycle is governed by cyclin-dependent protein kinases (CDKs) whose activities are regulated by cyclins and CDK inhibitors. The protein encoded by this gene is a member of the cyclin family and contains the cyclin box. The encoded protein lacks the protein destabilizing (PEST) sequence that is present in other family members. Transcriptional activation of this gene can be induced by tumor protein p53. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Depending on the allele, homozygous mutants exhibit increased cellular sensitivity to gamma-irradiation or decreased incidence of induced hepatic tumors. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(2) Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,199,824 probably null Het
2210010C04Rik A G 6: 41,032,936 probably null Het
2410089E03Rik T A 15: 8,226,900 probably null Het
Abca8a G A 11: 110,091,580 T12M probably damaging Het
Alms1 T A 6: 85,629,052 Y2561* probably null Het
Atp10a G A 7: 58,786,505 V348I probably damaging Het
Best2 T C 8: 85,011,223 Y181C probably benign Het
Btaf1 T A 19: 36,969,121 D442E probably damaging Het
C330027C09Rik C T 16: 49,005,719 T383I probably benign Het
Carmil3 T G 14: 55,504,532 V1153G probably benign Het
Cc2d2a A G 5: 43,718,661 I993M probably damaging Het
Cmtr2 T C 8: 110,222,798 L580P probably damaging Het
Col22a1 T C 15: 72,006,981 E109G possibly damaging Het
Crispld2 G T 8: 120,023,649 W264L possibly damaging Het
Cyp2c38 T C 19: 39,404,795 H276R probably benign Het
Dag1 A T 9: 108,208,715 V409E possibly damaging Het
Emc8 T C 8: 120,658,555 N146S probably benign Het
Glt8d1 T C 14: 31,011,521 V321A possibly damaging Het
Gm5174 C T 10: 86,656,912 noncoding transcript Het
Hdac10 G T 15: 89,126,709 probably null Het
Hectd4 A G 5: 121,344,818 D3144G possibly damaging Het
Ifna11 C T 4: 88,820,236 S93L probably damaging Het
Il16 T C 7: 83,648,728 N431S probably benign Het
Irf8 A T 8: 120,754,388 E237V probably damaging Het
Lrp1b A G 2: 41,185,981 Y1769H probably damaging Het
Lrrc9 A G 12: 72,477,299 N761D probably damaging Het
Mbtps1 T C 8: 119,542,730 Y207C probably benign Het
Myo9a A G 9: 59,832,300 E765G probably damaging Het
Nlrp3 A G 11: 59,543,351 D80G probably damaging Het
Olfr361 G A 2: 37,085,176 P191S probably damaging Het
Olfr697 G C 7: 106,741,548 P129A probably damaging Het
Olfr830 A T 9: 18,875,794 I156F probably benign Het
Pcyt2 T A 11: 120,615,851 probably null Het
Plxnd1 T C 6: 115,968,681 T944A probably benign Het
Psd4 A T 2: 24,405,332 I833F probably damaging Het
Psmd7 A G 8: 107,581,185 I222T probably benign Het
Rap2b A G 3: 61,365,190 E45G probably damaging Het
Rbm22 T C 18: 60,560,844 S7P possibly damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rfx4 A G 10: 84,844,280 N107S probably damaging Het
Ripk2 T A 4: 16,155,192 probably null Het
Rpgrip1 T A 14: 52,140,691 C499S possibly damaging Het
Scarf1 T C 11: 75,524,044 S515P probably damaging Het
Sgip1 T C 4: 102,915,059 V215A probably benign Het
Sis T C 3: 72,889,010 I1813V possibly damaging Het
Slc17a3 A T 13: 23,856,741 T317S probably benign Het
Slc35e1 T C 8: 72,483,977 N340S probably benign Het
Smg6 A G 11: 74,929,430 I176V probably benign Het
Smim17 T C 7: 6,429,326 L89S probably damaging Het
Synm T C 7: 67,736,303 N95S probably damaging Het
Tdrd9 A G 12: 112,036,439 K841E possibly damaging Het
Tep1 G T 14: 50,854,567 F570L possibly damaging Het
Tgm3 G A 2: 130,026,814 probably null Het
Tra2b T C 16: 22,252,746 Y128C possibly damaging Het
Vmn2r17 T C 5: 109,428,244 V327A probably benign Het
Wdr20rt A T 12: 65,227,314 D344V probably damaging Het
Zfp940 A G 7: 29,844,938 C515R probably damaging Het
Other mutations in Ccng1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Ccng1 APN 11 40754058 missense probably benign 0.00
IGL01875:Ccng1 APN 11 40752356 missense probably benign 0.09
IGL02986:Ccng1 APN 11 40750863 utr 3 prime probably benign
G5030:Ccng1 UTSW 11 40753802 splice site probably benign
R1375:Ccng1 UTSW 11 40752114 missense probably benign 0.02
R1377:Ccng1 UTSW 11 40752114 missense probably benign 0.02
R3620:Ccng1 UTSW 11 40752165 missense probably benign 0.01
R3857:Ccng1 UTSW 11 40753833 missense probably damaging 0.99
R3858:Ccng1 UTSW 11 40753833 missense probably damaging 0.99
R5082:Ccng1 UTSW 11 40752188 missense possibly damaging 0.77
R5172:Ccng1 UTSW 11 40751286 missense probably benign
R5521:Ccng1 UTSW 11 40752266 missense possibly damaging 0.87
R7431:Ccng1 UTSW 11 40753918 missense possibly damaging 0.74
R7961:Ccng1 UTSW 11 40751269 missense probably benign 0.00
R8009:Ccng1 UTSW 11 40751269 missense probably benign 0.00
T0975:Ccng1 UTSW 11 40754044 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGACTGGCAGGCATCTTTTCACTTC -3'
(R):5'- ACCCAAAGCCACTGGTTTCAAGTAG -3'

Sequencing Primer
(F):5'- CACTTCTGTTAGGCAGCAAAG -3'
(R):5'- GTGTCCTACTGAAGCACTGTAAAG -3'
Posted On2014-05-14