Incidental Mutation 'R1715:Scarf1'
ID190951
Institutional Source Beutler Lab
Gene Symbol Scarf1
Ensembl Gene ENSMUSG00000038188
Gene Namescavenger receptor class F, member 1
SynonymsSREC-I, SREC
MMRRC Submission 039748-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1715 (G1)
Quality Score171
Status Not validated
Chromosome11
Chromosomal Location75513540-75526582 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75524044 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 515 (S515P)
Ref Sequence ENSEMBL: ENSMUSP00000044248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042808] [ENSMUST00000118243] [ENSMUST00000123819]
Predicted Effect probably damaging
Transcript: ENSMUST00000042808
AA Change: S515P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044248
Gene: ENSMUSG00000038188
AA Change: S515P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 54 90 2.16e1 SMART
EGF 101 133 1.36e1 SMART
EGF_like 165 193 4.55e1 SMART
EGF_Lam 225 263 8.78e-2 SMART
EGF_like 262 296 4.93e1 SMART
EGF 307 341 2.69e1 SMART
EGF 352 384 2.25e1 SMART
transmembrane domain 424 446 N/A INTRINSIC
low complexity region 520 535 N/A INTRINSIC
low complexity region 791 805 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118243
SMART Domains Protein: ENSMUSP00000114090
Gene: ENSMUSG00000038188

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 54 90 2.16e1 SMART
EGF 101 133 1.36e1 SMART
EGF_like 165 193 4.55e1 SMART
EGF_Lam 225 263 8.78e-2 SMART
EGF_like 262 296 4.93e1 SMART
EGF 307 341 2.69e1 SMART
EGF 352 384 2.25e1 SMART
transmembrane domain 424 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123819
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a scavenger receptor that is expressed in endothelial cells. It regulates the uptake of chemically modified low density lipoproteins, including acetylated low density lipoprotein (Ac-LDL), and it may be involved in atherogenesis. This gene is regulated by the transcription factors ZNF444/EZF-2 and SP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous null mice are viable and fertile with no abnormalities detected in plasma glucose, cholesterol, or triglycerides, or in the brain, lung, heart, kidney, liver, or testes. Mice homozygous for a targeted allele exhibit impaired clearance of apoptotic cells and autoimmune disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,199,824 probably null Het
2210010C04Rik A G 6: 41,032,936 probably null Het
2410089E03Rik T A 15: 8,226,900 probably null Het
Abca8a G A 11: 110,091,580 T12M probably damaging Het
Alms1 T A 6: 85,629,052 Y2561* probably null Het
Atp10a G A 7: 58,786,505 V348I probably damaging Het
Best2 T C 8: 85,011,223 Y181C probably benign Het
Btaf1 T A 19: 36,969,121 D442E probably damaging Het
C330027C09Rik C T 16: 49,005,719 T383I probably benign Het
Carmil3 T G 14: 55,504,532 V1153G probably benign Het
Cc2d2a A G 5: 43,718,661 I993M probably damaging Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Cmtr2 T C 8: 110,222,798 L580P probably damaging Het
Col22a1 T C 15: 72,006,981 E109G possibly damaging Het
Crispld2 G T 8: 120,023,649 W264L possibly damaging Het
Cyp2c38 T C 19: 39,404,795 H276R probably benign Het
Dag1 A T 9: 108,208,715 V409E possibly damaging Het
Emc8 T C 8: 120,658,555 N146S probably benign Het
Glt8d1 T C 14: 31,011,521 V321A possibly damaging Het
Gm5174 C T 10: 86,656,912 noncoding transcript Het
Hdac10 G T 15: 89,126,709 probably null Het
Hectd4 A G 5: 121,344,818 D3144G possibly damaging Het
Ifna11 C T 4: 88,820,236 S93L probably damaging Het
Il16 T C 7: 83,648,728 N431S probably benign Het
Irf8 A T 8: 120,754,388 E237V probably damaging Het
Lrp1b A G 2: 41,185,981 Y1769H probably damaging Het
Lrrc9 A G 12: 72,477,299 N761D probably damaging Het
Mbtps1 T C 8: 119,542,730 Y207C probably benign Het
Myo9a A G 9: 59,832,300 E765G probably damaging Het
Nlrp3 A G 11: 59,543,351 D80G probably damaging Het
Olfr361 G A 2: 37,085,176 P191S probably damaging Het
Olfr697 G C 7: 106,741,548 P129A probably damaging Het
Olfr830 A T 9: 18,875,794 I156F probably benign Het
Pcyt2 T A 11: 120,615,851 probably null Het
Plxnd1 T C 6: 115,968,681 T944A probably benign Het
Psd4 A T 2: 24,405,332 I833F probably damaging Het
Psmd7 A G 8: 107,581,185 I222T probably benign Het
Rap2b A G 3: 61,365,190 E45G probably damaging Het
Rbm22 T C 18: 60,560,844 S7P possibly damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rfx4 A G 10: 84,844,280 N107S probably damaging Het
Ripk2 T A 4: 16,155,192 probably null Het
Rpgrip1 T A 14: 52,140,691 C499S possibly damaging Het
Sgip1 T C 4: 102,915,059 V215A probably benign Het
Sis T C 3: 72,889,010 I1813V possibly damaging Het
Slc17a3 A T 13: 23,856,741 T317S probably benign Het
Slc35e1 T C 8: 72,483,977 N340S probably benign Het
Smg6 A G 11: 74,929,430 I176V probably benign Het
Smim17 T C 7: 6,429,326 L89S probably damaging Het
Synm T C 7: 67,736,303 N95S probably damaging Het
Tdrd9 A G 12: 112,036,439 K841E possibly damaging Het
Tep1 G T 14: 50,854,567 F570L possibly damaging Het
Tgm3 G A 2: 130,026,814 probably null Het
Tra2b T C 16: 22,252,746 Y128C possibly damaging Het
Vmn2r17 T C 5: 109,428,244 V327A probably benign Het
Wdr20rt A T 12: 65,227,314 D344V probably damaging Het
Zfp940 A G 7: 29,844,938 C515R probably damaging Het
Other mutations in Scarf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Scarf1 APN 11 75521957 missense probably damaging 0.98
IGL02968:Scarf1 APN 11 75524089 missense probably damaging 1.00
R0078:Scarf1 UTSW 11 75515162 splice site probably benign
R0606:Scarf1 UTSW 11 75514348 missense probably damaging 0.98
R0834:Scarf1 UTSW 11 75514403 nonsense probably null
R2327:Scarf1 UTSW 11 75526028 missense probably damaging 1.00
R2483:Scarf1 UTSW 11 75515291 missense probably damaging 0.98
R3699:Scarf1 UTSW 11 75514369 missense probably damaging 1.00
R3831:Scarf1 UTSW 11 75515252 missense probably damaging 1.00
R3832:Scarf1 UTSW 11 75515252 missense probably damaging 1.00
R3833:Scarf1 UTSW 11 75515252 missense probably damaging 1.00
R4957:Scarf1 UTSW 11 75525634 missense probably benign 0.10
R4990:Scarf1 UTSW 11 75526015 missense probably benign 0.00
R4992:Scarf1 UTSW 11 75522230 missense probably damaging 1.00
R4992:Scarf1 UTSW 11 75526015 missense probably benign 0.00
R5291:Scarf1 UTSW 11 75524074 missense probably damaging 1.00
R5330:Scarf1 UTSW 11 75515580 missense probably damaging 1.00
R5331:Scarf1 UTSW 11 75515580 missense probably damaging 1.00
R5537:Scarf1 UTSW 11 75525531 missense probably damaging 1.00
R5583:Scarf1 UTSW 11 75514016 missense possibly damaging 0.95
R5592:Scarf1 UTSW 11 75525687 missense probably benign 0.08
R6130:Scarf1 UTSW 11 75525739 missense probably benign
R6289:Scarf1 UTSW 11 75525416 missense possibly damaging 0.83
R6313:Scarf1 UTSW 11 75520315 missense probably benign 0.02
R6360:Scarf1 UTSW 11 75515669 missense probably damaging 1.00
R6944:Scarf1 UTSW 11 75522206 missense probably benign 0.00
R7113:Scarf1 UTSW 11 75526078 missense probably damaging 0.99
R7624:Scarf1 UTSW 11 75514416 splice site probably null
R8191:Scarf1 UTSW 11 75522239 missense probably benign 0.01
R8258:Scarf1 UTSW 11 75523863 missense probably damaging 0.97
R8259:Scarf1 UTSW 11 75523863 missense probably damaging 0.97
R8433:Scarf1 UTSW 11 75521032 critical splice donor site probably null
Z1088:Scarf1 UTSW 11 75525490 missense probably damaging 1.00
Z1177:Scarf1 UTSW 11 75515247 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGAAACATCCTGCCAGTCTGAC -3'
(R):5'- AATAAGCGCGGACAGACATCTGCC -3'

Sequencing Primer
(F):5'- CCTTTTTCAGAATGAAGCAGCAGG -3'
(R):5'- ggacagacatctgccaaagg -3'
Posted On2014-05-14