Mutagenetix > Incidental Mutations

Incidental Mutation 'R1715:Btaf1'

190970

Institutional Source

Beutler Lab

Gene Symbol

Btaf1

Ensembl Gene

ENSMUSG00000040565

Gene Name

B-TFIID TATA-box binding protein associated factor 1

Synonyms

E430027O22Rik

MMRRC Submission

039748-MU

Accession Numbers

Genbank: NM_001080706

Is this an essential gene?

Probably essential (E-score: 0.966) question?

Stock #

R1715 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

36926079-37012752 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 36969121 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 442 (D442E)

Ref Sequence

ENSEMBL: ENSMUSP00000097093 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099494]

AlphaFold

E9QAE3

Predicted Effect

probably damaging
Transcript: ENSMUST00000099494
AA Change: D442E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000097093
Gene: ENSMUSG00000040565
AA Change: D442E

Domain	Start	End	E-Value	Type
low complexity region	87	98	N/A	INTRINSIC
low complexity region	143	152	N/A	INTRINSIC
PDB:3OC3\|B	276	414	3e-6	PDB
low complexity region	438	454	N/A	INTRINSIC
Pfam:DUF3535	585	1051	1.1e-133	PFAM
low complexity region	1099	1110	N/A	INTRINSIC
low complexity region	1177	1192	N/A	INTRINSIC
DEXDc	1261	1469	3.02e-30	SMART
low complexity region	1630	1641	N/A	INTRINSIC
HELICc	1657	1743	2.22e-19	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TAF (TATA box-binding protein-associated factor), which associates with TBP (TATA box-binding protein) to form the B-TFIID complex that is required for transcription initiation of genes by RNA polymerase II. This TAF has DNA-dependent ATPase activity, which drives the dissociation of TBP from DNA, freeing the TBP to associate with other TATA boxes or TATA-less promoters. [provided by RefSeq, Sep 2011]
PHENOTYPE: Embryos homozygous for a gene-trapped allele display growth retardation. Embryos homozygous for an ENU-induced allele show growth retardation, edema, abnormal blood circulation, myocardial trabeculae hypoplasia, and delayed head and brain development. [provided by MGI curators]

Allele List at MGI

All alleles(40) : Gene trapped(40)

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700023F06Rik	T	C	11: 103,199,824		probably null	Het
2210010C04Rik	A	G	6: 41,032,936		probably null	Het
2410089E03Rik	T	A	15: 8,226,900		probably null	Het
Abca8a	G	A	11: 110,091,580	T12M	probably damaging	Het
Alms1	T	A	6: 85,629,052	Y2561*	probably null	Het
Atp10a	G	A	7: 58,786,505	V348I	probably damaging	Het
Best2	T	C	8: 85,011,223	Y181C	probably benign	Het
C330027C09Rik	C	T	16: 49,005,719	T383I	probably benign	Het
Carmil3	T	G	14: 55,504,532	V1153G	probably benign	Het
Cc2d2a	A	G	5: 43,718,661	I993M	probably damaging	Het
Ccng1	G	A	11: 40,752,114	P169S	probably benign	Het
Cmtr2	T	C	8: 110,222,798	L580P	probably damaging	Het
Col22a1	T	C	15: 72,006,981	E109G	possibly damaging	Het
Crispld2	G	T	8: 120,023,649	W264L	possibly damaging	Het
Cyp2c38	T	C	19: 39,404,795	H276R	probably benign	Het
Dag1	A	T	9: 108,208,715	V409E	possibly damaging	Het
Emc8	T	C	8: 120,658,555	N146S	probably benign	Het
Glt8d1	T	C	14: 31,011,521	V321A	possibly damaging	Het
Gm5174	C	T	10: 86,656,912		noncoding transcript	Het
Hdac10	G	T	15: 89,126,709		probably null	Het
Hectd4	A	G	5: 121,344,818	D3144G	possibly damaging	Het
Ifna11	C	T	4: 88,820,236	S93L	probably damaging	Het
Il16	T	C	7: 83,648,728	N431S	probably benign	Het
Irf8	A	T	8: 120,754,388	E237V	probably damaging	Het
Lrp1b	A	G	2: 41,185,981	Y1769H	probably damaging	Het
Lrrc9	A	G	12: 72,477,299	N761D	probably damaging	Het
Mbtps1	T	C	8: 119,542,730	Y207C	probably benign	Het
Myo9a	A	G	9: 59,832,300	E765G	probably damaging	Het
Nlrp3	A	G	11: 59,543,351	D80G	probably damaging	Het
Olfr361	G	A	2: 37,085,176	P191S	probably damaging	Het
Olfr697	G	C	7: 106,741,548	P129A	probably damaging	Het
Olfr830	A	T	9: 18,875,794	I156F	probably benign	Het
Pcyt2	T	A	11: 120,615,851		probably null	Het
Plxnd1	T	C	6: 115,968,681	T944A	probably benign	Het
Psd4	A	T	2: 24,405,332	I833F	probably damaging	Het
Psmd7	A	G	8: 107,581,185	I222T	probably benign	Het
Rap2b	A	G	3: 61,365,190	E45G	probably damaging	Het
Rbm22	T	C	18: 60,560,844	S7P	possibly damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Rfx4	A	G	10: 84,844,280	N107S	probably damaging	Het
Ripk2	T	A	4: 16,155,192		probably null	Het
Rpgrip1	T	A	14: 52,140,691	C499S	possibly damaging	Het
Scarf1	T	C	11: 75,524,044	S515P	probably damaging	Het
Sgip1	T	C	4: 102,915,059	V215A	probably benign	Het
Sis	T	C	3: 72,889,010	I1813V	possibly damaging	Het
Slc17a3	A	T	13: 23,856,741	T317S	probably benign	Het
Slc35e1	T	C	8: 72,483,977	N340S	probably benign	Het
Smg6	A	G	11: 74,929,430	I176V	probably benign	Het
Smim17	T	C	7: 6,429,326	L89S	probably damaging	Het
Synm	T	C	7: 67,736,303	N95S	probably damaging	Het
Tdrd9	A	G	12: 112,036,439	K841E	possibly damaging	Het
Tep1	G	T	14: 50,854,567	F570L	possibly damaging	Het
Tgm3	G	A	2: 130,026,814		probably null	Het
Tra2b	T	C	16: 22,252,746	Y128C	possibly damaging	Het
Vmn2r17	T	C	5: 109,428,244	V327A	probably benign	Het
Wdr20rt	A	T	12: 65,227,314	D344V	probably damaging	Het
Zfp940	A	G	7: 29,844,938	C515R	probably damaging	Het

Other mutations in Btaf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Btaf1	APN	19	37009702	missense	probably damaging	1.00
IGL00535:Btaf1	APN	19	36997535	missense	probably damaging	1.00
IGL00574:Btaf1	APN	19	36969930	missense	probably benign	0.00
IGL00969:Btaf1	APN	19	37011252	splice site	probably benign
IGL01325:Btaf1	APN	19	37004649	splice site	probably benign
IGL01399:Btaf1	APN	19	37000170	nonsense	probably null
IGL02024:Btaf1	APN	19	36992426	splice site	probably benign
IGL02471:Btaf1	APN	19	37000192	missense	probably damaging	0.96
IGL02664:Btaf1	APN	19	36978428	splice site	probably benign
IGL02898:Btaf1	APN	19	36969068	missense	probably benign
IGL02995:Btaf1	APN	19	36981135	splice site	probably benign
IGL03023:Btaf1	APN	19	37010015	missense	possibly damaging	0.85
IGL03188:Btaf1	APN	19	36949108	missense	possibly damaging	0.91
IGL03353:Btaf1	APN	19	36992500	missense	probably damaging	1.00
freudenberg	UTSW	19	36988173	critical splice donor site	probably null
Galanos	UTSW	19	36949102	missense	probably damaging	1.00
3-1:Btaf1	UTSW	19	37010078	missense	probably damaging	1.00
R0013:Btaf1	UTSW	19	36958373	missense	probably benign
R0048:Btaf1	UTSW	19	37003524	missense	probably benign	0.01
R0117:Btaf1	UTSW	19	36969968	missense	probably benign	0.06
R0207:Btaf1	UTSW	19	37009648	nonsense	probably null
R0310:Btaf1	UTSW	19	37004534	missense	probably damaging	0.96
R0377:Btaf1	UTSW	19	36989002	missense	probably benign
R0419:Btaf1	UTSW	19	36945229	missense	probably damaging	0.99
R0440:Btaf1	UTSW	19	36986653	missense	probably damaging	0.99
R0532:Btaf1	UTSW	19	36951186	splice site	probably benign
R0612:Btaf1	UTSW	19	36969137	missense	probably damaging	0.99
R0731:Btaf1	UTSW	19	36997495	splice site	probably null
R0780:Btaf1	UTSW	19	36988922	missense	probably damaging	0.99
R0919:Btaf1	UTSW	19	36990743	missense	probably benign	0.03
R1104:Btaf1	UTSW	19	37004602	missense	probably damaging	1.00
R1263:Btaf1	UTSW	19	36956524	missense	probably benign	0.10
R1325:Btaf1	UTSW	19	36969162	missense	possibly damaging	0.68
R1447:Btaf1	UTSW	19	36992454	missense	probably benign	0.00
R1554:Btaf1	UTSW	19	36996598	missense	probably benign	0.02
R1649:Btaf1	UTSW	19	36981722	missense	probably benign
R1733:Btaf1	UTSW	19	36994962	missense	probably benign
R1764:Btaf1	UTSW	19	36951118	missense	probably benign	0.12
R1874:Btaf1	UTSW	19	36980583	missense	probably benign
R1911:Btaf1	UTSW	19	36986630	missense	probably benign
R1933:Btaf1	UTSW	19	36972957	missense	probably damaging	1.00
R2080:Btaf1	UTSW	19	36951148	missense	probably benign	0.09
R2483:Btaf1	UTSW	19	36981086	missense	probably benign	0.02
R2510:Btaf1	UTSW	19	37002445	missense	probably benign	0.08
R3623:Btaf1	UTSW	19	36981086	missense	probably benign	0.02
R3624:Btaf1	UTSW	19	36981086	missense	probably benign	0.02
R3801:Btaf1	UTSW	19	36986548	missense	probably benign
R3801:Btaf1	UTSW	19	36988973	missense	probably benign	0.00
R3802:Btaf1	UTSW	19	36986548	missense	probably benign
R3802:Btaf1	UTSW	19	36988973	missense	probably benign	0.00
R3803:Btaf1	UTSW	19	36986548	missense	probably benign
R3803:Btaf1	UTSW	19	36988973	missense	probably benign	0.00
R4077:Btaf1	UTSW	19	36986479	missense	probably benign	0.00
R4079:Btaf1	UTSW	19	36986479	missense	probably benign	0.00
R4133:Btaf1	UTSW	19	36961738	missense	probably benign	0.00
R4673:Btaf1	UTSW	19	36978372	missense	probably benign	0.00
R4731:Btaf1	UTSW	19	36981078	missense	probably benign	0.03
R4796:Btaf1	UTSW	19	36956428	missense	possibly damaging	0.95
R4824:Btaf1	UTSW	19	36981048	missense	possibly damaging	0.84
R4835:Btaf1	UTSW	19	37002458	missense	probably benign	0.00
R4837:Btaf1	UTSW	19	36966785	missense	probably benign
R4925:Btaf1	UTSW	19	37011333	missense	probably benign
R4968:Btaf1	UTSW	19	36969951	missense	probably null	0.71
R4976:Btaf1	UTSW	19	36986579	missense	probably benign
R5001:Btaf1	UTSW	19	36986652	missense	possibly damaging	0.90
R5037:Btaf1	UTSW	19	37003531	missense	probably damaging	1.00
R5039:Btaf1	UTSW	19	36990762	missense	probably benign
R5211:Btaf1	UTSW	19	36996562	missense	probably benign	0.32
R5422:Btaf1	UTSW	19	36951107	missense	probably benign	0.09
R5429:Btaf1	UTSW	19	36994857	missense	possibly damaging	0.58
R5530:Btaf1	UTSW	19	36990775	missense	possibly damaging	0.85
R5582:Btaf1	UTSW	19	36988173	critical splice donor site	probably null
R5654:Btaf1	UTSW	19	36983615	missense	probably benign	0.35
R5744:Btaf1	UTSW	19	37004490	missense	probably benign	0.02
R6082:Btaf1	UTSW	19	36983542	missense	probably damaging	1.00
R6243:Btaf1	UTSW	19	36981120	missense	probably benign	0.02
R6291:Btaf1	UTSW	19	36973008	missense	probably benign	0.00
R6502:Btaf1	UTSW	19	36983617	missense	probably benign
R7034:Btaf1	UTSW	19	37004469	missense	probably benign
R7036:Btaf1	UTSW	19	37004469	missense	probably benign
R7085:Btaf1	UTSW	19	36972918	missense	probably benign
R7097:Btaf1	UTSW	19	36949102	missense	probably damaging	1.00
R7248:Btaf1	UTSW	19	36945314	missense	possibly damaging	0.54
R7386:Btaf1	UTSW	19	36958382	missense	probably benign	0.02
R7402:Btaf1	UTSW	19	37003515	missense	probably damaging	1.00
R7452:Btaf1	UTSW	19	36969127	missense	probably damaging	1.00
R7493:Btaf1	UTSW	19	37009605	missense	probably damaging	1.00
R7513:Btaf1	UTSW	19	36978403	missense	probably benign	0.30
R7888:Btaf1	UTSW	19	36965636	missense	probably benign	0.10
R7944:Btaf1	UTSW	19	36949165	missense	probably benign
R8062:Btaf1	UTSW	19	36992465	missense	probably benign	0.00
R8559:Btaf1	UTSW	19	36986873	missense	probably benign	0.00
R8793:Btaf1	UTSW	19	36981029	missense	probably benign	0.21
R8855:Btaf1	UTSW	19	36958501	missense	probably benign
R8866:Btaf1	UTSW	19	36958501	missense	probably benign
R9016:Btaf1	UTSW	19	36994305	missense	probably benign	0.00
R9028:Btaf1	UTSW	19	36969108	missense	probably damaging	1.00
R9109:Btaf1	UTSW	19	36986714	missense	probably benign
R9172:Btaf1	UTSW	19	37000230	missense	probably damaging	0.98
R9298:Btaf1	UTSW	19	36986714	missense	probably benign
W0251:Btaf1	UTSW	19	37003504	missense	probably damaging	1.00
X0027:Btaf1	UTSW	19	36949096	nonsense	probably null
Z1088:Btaf1	UTSW	19	36986618	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCTAAGGGTCTTGACAGGGACATACATA -3'
(R):5'- AGGGTCACTACGAGTCAATAGCATACA -3'

Sequencing Primer
(F):5'- TGTTCTGGTATTTCAAGTTACATCC -3'
(R):5'- TCTGTGTACTAAGTACAGAAAGGG -3'

Posted On

2014-05-14