Incidental Mutation 'R1715:Hdac10'
ID190965
Institutional Source Beutler Lab
Gene Symbol Hdac10
Ensembl Gene ENSMUSG00000062906
Gene Namehistone deacetylase 10
Synonyms
MMRRC Submission 039748-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1715 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location89123307-89128700 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 89126709 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041656] [ENSMUST00000082197] [ENSMUST00000088827] [ENSMUST00000109347] [ENSMUST00000109347] [ENSMUST00000109353]
Predicted Effect probably benign
Transcript: ENSMUST00000041656
SMART Domains Protein: ENSMUSP00000040132
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1667 3.3e-119 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000082197
SMART Domains Protein: ENSMUSP00000080832
Gene: ENSMUSG00000062906

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 13 322 2.1e-85 PFAM
low complexity region 478 489 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088827
SMART Domains Protein: ENSMUSP00000086207
Gene: ENSMUSG00000022610

DomainStartEndE-ValueType
S_TKc 27 311 1.63e-96 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109347
SMART Domains Protein: ENSMUSP00000104971
Gene: ENSMUSG00000062906

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 13 251 6.1e-66 PFAM
low complexity region 270 282 N/A INTRINSIC
low complexity region 398 409 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109347
SMART Domains Protein: ENSMUSP00000104971
Gene: ENSMUSG00000062906

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 13 251 6.1e-66 PFAM
low complexity region 270 282 N/A INTRINSIC
low complexity region 398 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109353
SMART Domains Protein: ENSMUSP00000104977
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1675 2.8e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129398
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230352
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the histone deacetylase family, members of which deacetylate lysine residues on the N-terminal part of the core histones. Histone deacetylation modulates chromatin structure, and plays an important role in transcriptional regulation, cell cycle progression, and developmental events. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,199,824 probably null Het
2210010C04Rik A G 6: 41,032,936 probably null Het
2410089E03Rik T A 15: 8,226,900 probably null Het
Abca8a G A 11: 110,091,580 T12M probably damaging Het
Alms1 T A 6: 85,629,052 Y2561* probably null Het
Atp10a G A 7: 58,786,505 V348I probably damaging Het
Best2 T C 8: 85,011,223 Y181C probably benign Het
Btaf1 T A 19: 36,969,121 D442E probably damaging Het
C330027C09Rik C T 16: 49,005,719 T383I probably benign Het
Carmil3 T G 14: 55,504,532 V1153G probably benign Het
Cc2d2a A G 5: 43,718,661 I993M probably damaging Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Cmtr2 T C 8: 110,222,798 L580P probably damaging Het
Col22a1 T C 15: 72,006,981 E109G possibly damaging Het
Crispld2 G T 8: 120,023,649 W264L possibly damaging Het
Cyp2c38 T C 19: 39,404,795 H276R probably benign Het
Dag1 A T 9: 108,208,715 V409E possibly damaging Het
Emc8 T C 8: 120,658,555 N146S probably benign Het
Glt8d1 T C 14: 31,011,521 V321A possibly damaging Het
Gm5174 C T 10: 86,656,912 noncoding transcript Het
Hectd4 A G 5: 121,344,818 D3144G possibly damaging Het
Ifna11 C T 4: 88,820,236 S93L probably damaging Het
Il16 T C 7: 83,648,728 N431S probably benign Het
Irf8 A T 8: 120,754,388 E237V probably damaging Het
Lrp1b A G 2: 41,185,981 Y1769H probably damaging Het
Lrrc9 A G 12: 72,477,299 N761D probably damaging Het
Mbtps1 T C 8: 119,542,730 Y207C probably benign Het
Myo9a A G 9: 59,832,300 E765G probably damaging Het
Nlrp3 A G 11: 59,543,351 D80G probably damaging Het
Olfr361 G A 2: 37,085,176 P191S probably damaging Het
Olfr697 G C 7: 106,741,548 P129A probably damaging Het
Olfr830 A T 9: 18,875,794 I156F probably benign Het
Pcyt2 T A 11: 120,615,851 probably null Het
Plxnd1 T C 6: 115,968,681 T944A probably benign Het
Psd4 A T 2: 24,405,332 I833F probably damaging Het
Psmd7 A G 8: 107,581,185 I222T probably benign Het
Rap2b A G 3: 61,365,190 E45G probably damaging Het
Rbm22 T C 18: 60,560,844 S7P possibly damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rfx4 A G 10: 84,844,280 N107S probably damaging Het
Ripk2 T A 4: 16,155,192 probably null Het
Rpgrip1 T A 14: 52,140,691 C499S possibly damaging Het
Scarf1 T C 11: 75,524,044 S515P probably damaging Het
Sgip1 T C 4: 102,915,059 V215A probably benign Het
Sis T C 3: 72,889,010 I1813V possibly damaging Het
Slc17a3 A T 13: 23,856,741 T317S probably benign Het
Slc35e1 T C 8: 72,483,977 N340S probably benign Het
Smg6 A G 11: 74,929,430 I176V probably benign Het
Smim17 T C 7: 6,429,326 L89S probably damaging Het
Synm T C 7: 67,736,303 N95S probably damaging Het
Tdrd9 A G 12: 112,036,439 K841E possibly damaging Het
Tep1 G T 14: 50,854,567 F570L possibly damaging Het
Tgm3 G A 2: 130,026,814 probably null Het
Tra2b T C 16: 22,252,746 Y128C possibly damaging Het
Vmn2r17 T C 5: 109,428,244 V327A probably benign Het
Wdr20rt A T 12: 65,227,314 D344V probably damaging Het
Zfp940 A G 7: 29,844,938 C515R probably damaging Het
Other mutations in Hdac10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Hdac10 APN 15 89128442 missense probably damaging 1.00
IGL01063:Hdac10 APN 15 89123868 missense possibly damaging 0.68
IGL01577:Hdac10 APN 15 89126213 missense possibly damaging 0.90
IGL01690:Hdac10 APN 15 89125991 missense probably benign 0.00
IGL01724:Hdac10 APN 15 89124709 unclassified probably benign
IGL01866:Hdac10 APN 15 89124533 missense probably damaging 1.00
IGL01989:Hdac10 APN 15 89125343 missense probably damaging 1.00
IGL01995:Hdac10 APN 15 89127598 missense probably damaging 1.00
IGL02256:Hdac10 APN 15 89125894 unclassified probably benign
IGL02668:Hdac10 APN 15 89125644 missense probably benign 0.10
R0240:Hdac10 UTSW 15 89125882 missense possibly damaging 0.65
R0240:Hdac10 UTSW 15 89125882 missense possibly damaging 0.65
R0454:Hdac10 UTSW 15 89125758 splice site probably null
R0723:Hdac10 UTSW 15 89126418 missense probably damaging 1.00
R0924:Hdac10 UTSW 15 89125862 missense probably benign
R1553:Hdac10 UTSW 15 89125515 missense possibly damaging 0.51
R1608:Hdac10 UTSW 15 89125318 missense probably benign 0.04
R1619:Hdac10 UTSW 15 89126675 missense probably damaging 1.00
R2284:Hdac10 UTSW 15 89127404 missense probably benign 0.00
R2872:Hdac10 UTSW 15 89125856 missense possibly damaging 0.46
R2872:Hdac10 UTSW 15 89125856 missense possibly damaging 0.46
R3688:Hdac10 UTSW 15 89123564 critical splice donor site probably null
R4283:Hdac10 UTSW 15 89125623 missense possibly damaging 0.94
R4604:Hdac10 UTSW 15 89125397 critical splice acceptor site probably null
R4654:Hdac10 UTSW 15 89126833 unclassified probably benign
R4898:Hdac10 UTSW 15 89128447 start codon destroyed probably null 1.00
R4998:Hdac10 UTSW 15 89123940 missense possibly damaging 0.94
R5393:Hdac10 UTSW 15 89126684 missense probably damaging 1.00
R5769:Hdac10 UTSW 15 89123616 missense probably benign 0.00
R5785:Hdac10 UTSW 15 89126945 missense probably benign
R6992:Hdac10 UTSW 15 89125331 missense probably benign 0.01
R7149:Hdac10 UTSW 15 89127449 missense probably damaging 1.00
R7237:Hdac10 UTSW 15 89125377 missense probably benign
R7276:Hdac10 UTSW 15 89128285 missense probably benign 0.01
R7395:Hdac10 UTSW 15 89128284 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CGATAGCAGAGTCAAATCCAGCCG -3'
(R):5'- CCAAGGTTTCACTGTCAATTTGCCC -3'

Sequencing Primer
(F):5'- AGGTTAGACTTTCTGAGACACC -3'
(R):5'- ACTGTCAATTTGCCCTGGAAC -3'
Posted On2014-05-14