Incidental Mutation 'R1766:Nlrp4c'
ID194363
Institutional Source Beutler Lab
Gene Symbol Nlrp4c
Ensembl Gene ENSMUSG00000034690
Gene NameNLR family, pyrin domain containing 4C
SynonymsNalp-alpha, Rnh2, Nalp4c
MMRRC Submission 039798-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R1766 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location6045161-6105150 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6073114 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 671 (V671E)
Ref Sequence ENSEMBL: ENSMUSP00000146613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037728] [ENSMUST00000121583] [ENSMUST00000208360]
Predicted Effect probably benign
Transcript: ENSMUST00000037728
AA Change: V671E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000046503
Gene: ENSMUSG00000034690
AA Change: V671E

DomainStartEndE-ValueType
PYRIN 6 89 1.41e-34 SMART
Pfam:NACHT 148 317 4.5e-40 PFAM
LRR 689 716 2.91e0 SMART
LRR 718 745 1.49e1 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 6.24e1 SMART
LRR 802 829 3.07e-1 SMART
LRR 831 858 4.11e-1 SMART
LRR 859 886 3.31e-6 SMART
LRR 888 915 6.16e0 SMART
LRR 916 943 9.24e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121583
AA Change: V671E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113824
Gene: ENSMUSG00000034690
AA Change: V671E

DomainStartEndE-ValueType
PYRIN 6 89 1.41e-34 SMART
Pfam:NACHT 148 317 1.7e-39 PFAM
LRR 689 716 2.91e0 SMART
LRR 718 745 1.49e1 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 6.24e1 SMART
LRR 802 829 3.07e-1 SMART
LRR 831 858 4.11e-1 SMART
LRR 859 886 3.31e-6 SMART
LRR 888 915 6.16e0 SMART
LRR 916 943 9.24e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000208360
AA Change: V671E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933403O08Rik T C X: 112,241,085 Y22H probably benign Het
Afg1l T C 10: 42,454,495 T59A probably benign Het
Ankrd17 T A 5: 90,264,797 M1223L possibly damaging Het
Ankrd24 G A 10: 81,638,638 S68N probably benign Het
Arhgap31 A G 16: 38,625,590 I131T probably damaging Het
Arhgef10 A T 8: 14,979,836 I874F probably damaging Het
Arl5b T C 2: 15,069,837 V43A probably benign Het
BC051665 G A 13: 60,785,040 H36Y probably benign Het
Cdh9 A G 15: 16,778,306 D69G probably damaging Het
Chd6 G A 2: 160,966,639 L1552F probably damaging Het
Chrd A G 16: 20,737,441 H584R probably damaging Het
Dnhd1 G A 7: 105,693,972 V1508I possibly damaging Het
Dpy19l4 C T 4: 11,303,360 G187D probably damaging Het
Dync2h1 T C 9: 7,015,526 probably null Het
Ehbp1l1 A G 19: 5,716,406 V1303A probably damaging Het
Eif4e1b G A 13: 54,786,891 E182K probably damaging Het
Fam170b A T 14: 32,835,886 Q226L possibly damaging Het
Fam193a C T 5: 34,462,131 P760L probably damaging Het
Gabra5 A T 7: 57,508,048 L6H probably benign Het
Gabrq G A X: 72,833,383 R161H probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm7334 T A 17: 50,698,978 D97E probably damaging Het
Gpsm1 G A 2: 26,325,383 A286T probably damaging Het
Gsta4 C A 9: 78,204,329 Y79* probably null Het
Hcn1 T A 13: 117,656,734 V174D probably benign Het
Hic1 G T 11: 75,165,794 C756* probably null Het
Hivep3 C T 4: 120,096,671 T728I probably benign Het
Ice1 T C 13: 70,604,442 E1175G possibly damaging Het
Igsf3 T A 3: 101,431,282 L304Q probably damaging Het
Kpna6 T C 4: 129,657,442 D90G probably benign Het
Krt73 C T 15: 101,793,928 G500D probably damaging Het
Lama3 A G 18: 12,402,062 K156E probably damaging Het
Mdm2 T C 10: 117,696,022 K94E probably damaging Het
Mitf T C 6: 97,941,099 S26P probably damaging Het
Myh4 C A 11: 67,256,295 Q1589K possibly damaging Het
Nop9 C T 14: 55,752,134 A407V possibly damaging Het
Nrap T A 19: 56,335,042 H1366L probably damaging Het
Ntrk1 A T 3: 87,778,518 C766S probably damaging Het
Olfr625-ps1 A G 7: 103,682,861 N38D possibly damaging Het
Olfr735 T C 14: 50,346,220 Y43C probably damaging Het
Olfr768 T C 10: 129,093,747 I76V probably benign Het
Olfr845 A G 9: 19,338,858 T133A probably benign Het
Oog3 C T 4: 144,159,122 G302D possibly damaging Het
Pdzph1 C T 17: 58,973,752 V512I probably benign Het
Phf2 A C 13: 48,819,557 S408A unknown Het
Pigk T G 3: 152,740,156 L135V probably damaging Het
Ppp2ca C A 11: 52,121,946 T301N probably benign Het
Ppp4r3a A G 12: 101,058,482 S253P probably damaging Het
Ptgfrn A T 3: 101,050,122 I712N probably benign Het
Rapgef2 A T 3: 79,092,703 D579E probably damaging Het
Rims2 T A 15: 39,462,580 D769E probably damaging Het
Rptor T A 11: 119,725,061 C134S probably damaging Het
S100a1 A G 3: 90,511,292 F72L probably damaging Het
Scube1 T A 15: 83,721,945 D42V probably damaging Het
Sh3glb1 T C 3: 144,712,685 D39G probably damaging Het
Sh3pxd2a T C 19: 47,273,250 T397A probably benign Het
Siglece G A 7: 43,651,532 T453M probably damaging Het
Slc26a1 G A 5: 108,671,792 R514W probably damaging Het
Slc4a8 T C 15: 100,787,212 V156A probably benign Het
Smchd1 A T 17: 71,391,379 V1134E probably damaging Het
Sorbs2 A G 8: 45,770,576 Y222C probably damaging Het
Sorcs3 G T 19: 48,603,875 W326C possibly damaging Het
Taf2 A G 15: 55,071,397 V45A probably benign Het
Tiparp A T 3: 65,532,049 H80L probably damaging Het
Tmem71 T A 15: 66,541,699 T175S probably benign Het
Tmem87b T A 2: 128,839,170 V338D probably damaging Het
Trdn A G 10: 33,364,008 K445R probably damaging Het
Trim14 A G 4: 46,522,039 F213L probably benign Het
Tubgcp5 T A 7: 55,815,020 S550T probably benign Het
Tufm A G 7: 126,490,472 D446G probably benign Het
Vipr1 A T 9: 121,661,419 Y177F possibly damaging Het
Vmn2r116 A C 17: 23,401,766 I825L probably damaging Het
Vmn2r12 G T 5: 109,092,044 Q218K probably damaging Het
Vwa7 G T 17: 35,023,943 probably null Het
Ywhae T C 11: 75,755,665 V119A probably damaging Het
Zfand5 A G 19: 21,280,524 R199G probably damaging Het
Zfp810 T C 9: 22,278,532 Y360C possibly damaging Het
Zrsr1 A G 11: 22,973,637 D137G probably benign Het
Other mutations in Nlrp4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00727:Nlrp4c APN 7 6066702 missense possibly damaging 0.80
IGL01458:Nlrp4c APN 7 6100784 missense possibly damaging 0.94
IGL01464:Nlrp4c APN 7 6100784 missense possibly damaging 0.94
IGL01470:Nlrp4c APN 7 6100784 missense possibly damaging 0.94
IGL01481:Nlrp4c APN 7 6100784 missense possibly damaging 0.94
IGL01531:Nlrp4c APN 7 6060656 missense probably damaging 1.00
IGL01595:Nlrp4c APN 7 6066112 nonsense probably null
IGL02087:Nlrp4c APN 7 6092583 missense probably damaging 1.00
IGL02226:Nlrp4c APN 7 6066829 missense possibly damaging 0.78
IGL02588:Nlrp4c APN 7 6084648 missense probably benign 0.25
IGL02822:Nlrp4c APN 7 6065727 missense probably damaging 1.00
IGL02884:Nlrp4c APN 7 6098952 missense probably damaging 1.00
IGL02943:Nlrp4c APN 7 6065975 missense probably damaging 0.96
IGL03017:Nlrp4c APN 7 6084680 missense probably benign 0.23
R0347:Nlrp4c UTSW 7 6066416 missense possibly damaging 0.69
R0579:Nlrp4c UTSW 7 6060845 missense probably benign 0.05
R1051:Nlrp4c UTSW 7 6065943 missense probably benign 0.01
R1596:Nlrp4c UTSW 7 6066778 missense probably benign
R1636:Nlrp4c UTSW 7 6066738 missense possibly damaging 0.64
R1739:Nlrp4c UTSW 7 6073222 missense probably damaging 1.00
R1824:Nlrp4c UTSW 7 6066956 splice site probably null
R1827:Nlrp4c UTSW 7 6065766 missense probably damaging 1.00
R1858:Nlrp4c UTSW 7 6084656 missense probably benign 0.02
R1902:Nlrp4c UTSW 7 6065819 missense probably damaging 0.98
R2217:Nlrp4c UTSW 7 6073114 missense probably benign
R2415:Nlrp4c UTSW 7 6066048 missense probably damaging 1.00
R3004:Nlrp4c UTSW 7 6065525 missense probably benign 0.28
R3005:Nlrp4c UTSW 7 6065525 missense probably benign 0.28
R3410:Nlrp4c UTSW 7 6092570 missense possibly damaging 0.69
R3411:Nlrp4c UTSW 7 6092570 missense possibly damaging 0.69
R3710:Nlrp4c UTSW 7 6065628 missense probably damaging 0.99
R4072:Nlrp4c UTSW 7 6072710 missense probably benign 0.00
R4073:Nlrp4c UTSW 7 6072710 missense probably benign 0.00
R4075:Nlrp4c UTSW 7 6072710 missense probably benign 0.00
R4076:Nlrp4c UTSW 7 6072710 missense probably benign 0.00
R4542:Nlrp4c UTSW 7 6100827 nonsense probably null
R4709:Nlrp4c UTSW 7 6065425 missense probably benign 0.31
R4776:Nlrp4c UTSW 7 6066126 missense probably benign 0.41
R5043:Nlrp4c UTSW 7 6066825 missense probably benign 0.01
R5258:Nlrp4c UTSW 7 6066623 missense probably benign 0.06
R6164:Nlrp4c UTSW 7 6092508 missense probably damaging 1.00
R6383:Nlrp4c UTSW 7 6066053 missense probably benign
R6650:Nlrp4c UTSW 7 6065949 missense probably damaging 0.99
R6810:Nlrp4c UTSW 7 6066755 missense probably damaging 1.00
R7095:Nlrp4c UTSW 7 6060793 missense probably damaging 0.97
R7102:Nlrp4c UTSW 7 6065709 nonsense probably null
R7104:Nlrp4c UTSW 7 6065709 nonsense probably null
R7232:Nlrp4c UTSW 7 6065709 nonsense probably null
R7444:Nlrp4c UTSW 7 6092596 nonsense probably null
R7705:Nlrp4c UTSW 7 6072636 missense probably damaging 0.97
R7966:Nlrp4c UTSW 7 6066323 missense probably damaging 0.99
R8506:Nlrp4c UTSW 7 6100776 missense possibly damaging 0.47
R8677:Nlrp4c UTSW 7 6072645 missense probably damaging 0.99
R8708:Nlrp4c UTSW 7 6065604 missense probably damaging 1.00
R8838:Nlrp4c UTSW 7 6066338 missense
X0060:Nlrp4c UTSW 7 6065918 missense probably damaging 1.00
Z1088:Nlrp4c UTSW 7 6066636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTGTGTGGCTGACCATTCTTC -3'
(R):5'- TGCACTCTTCCTGGCTCAAGACATC -3'

Sequencing Primer
(F):5'- TGTGACAGCCAACCTTGC -3'
(R):5'- TCAAGACATCACACAACAGTTTC -3'
Posted On2014-05-23