Incidental Mutation 'R1768:Lama4'
ID 194606
Institutional Source Beutler Lab
Gene Symbol Lama4
Ensembl Gene ENSMUSG00000019846
Gene Name laminin, alpha 4
Synonyms laminin [a]4
MMRRC Submission 039799-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1768 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 38965515-39110188 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 39103501 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 1658 (N1658K)
Ref Sequence ENSEMBL: ENSMUSP00000019992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019992]
AlphaFold P97927
Predicted Effect possibly damaging
Transcript: ENSMUST00000019992
AA Change: N1658K

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000019992
Gene: ENSMUSG00000019846
AA Change: N1658K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
EGF_Lam 82 129 1.95e-8 SMART
EGF_Lam 132 184 5.78e-11 SMART
EGF_Lam 187 238 9.83e-14 SMART
Pfam:Laminin_I 283 548 5.3e-71 PFAM
coiled coil region 658 685 N/A INTRINSIC
LamG 850 1009 9.54e-11 SMART
LamG 1066 1205 5.9e-25 SMART
LamG 1250 1374 6.68e-24 SMART
LamG 1484 1619 1.54e-37 SMART
LamG 1661 1794 3.63e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163036
Meta Mutation Damage Score 0.1420 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 91% (107/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the alpha chain isoform laminin, alpha 4. The domain structure of alpha 4 is similar to that of alpha 3, both of which resemble truncated versions of alpha 1 and alpha 2, in that approximately 1,200 residues at the N-terminus (domains IV, V and VI) have been lost. Laminin, alpha 4 contains the C-terminal G domain which distinguishes all alpha chains from the beta and gamma chains. The RNA analysis from adult and fetal tissues revealed developmental regulation of expression, however, the exact function of laminin, alpha 4 is not known. Tissue-specific utilization of alternative polyA-signal has been described in literature. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired motor control of the hind limbs associated with improperly positioned synaptic active zones and junctional folds, and prenatal and neonatal hemorrhages associated with capillary defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G C 18: 6,623,470 R60P possibly damaging Het
Aox2 T A 1: 58,354,195 C1199S probably benign Het
Arhgap18 G A 10: 26,887,861 M482I probably damaging Het
Arhgap18 G T 10: 26,887,862 A483S probably damaging Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
BC051019 T C 7: 109,723,174 T38A probably benign Het
Bcam T C 7: 19,765,618 N192S probably null Het
Bend5 A T 4: 111,454,241 K351* probably null Het
Bicdl2 T A 17: 23,665,949 M208K probably damaging Het
Ccdc155 T A 7: 45,188,803 probably null Het
Ccp110 A T 7: 118,726,024 probably null Het
Cdc6 A T 11: 98,912,217 T328S probably damaging Het
Cdk5rap2 G T 4: 70,307,233 N558K probably benign Het
Cdkn1c C T 7: 143,459,121 R146K probably benign Het
Ceacam18 G A 7: 43,648,494 C371Y probably benign Het
Cep95 T A 11: 106,806,351 C233* probably null Het
Chrnd A G 1: 87,194,928 I144V probably benign Het
Col6a4 T A 9: 106,080,100 Q175L probably benign Het
Cym A T 3: 107,213,500 V263E probably damaging Het
Cyp2a4 G T 7: 26,312,772 V327F possibly damaging Het
Dhx29 T A 13: 112,948,240 M664K probably damaging Het
Dlec1 T G 9: 119,146,007 probably null Het
Dna2 T C 10: 62,957,084 Y293H probably benign Het
Dnase1l3 T A 14: 7,974,104 N196Y probably damaging Het
Eea1 T A 10: 95,996,960 D222E probably damaging Het
Efcab14 A T 4: 115,752,919 probably null Het
Entpd5 C T 12: 84,386,211 R189H probably benign Het
Exoc4 A T 6: 33,758,050 K534M probably damaging Het
Extl1 T A 4: 134,371,138 Y194F probably benign Het
Eya1 A G 1: 14,253,075 L161S possibly damaging Het
Fam163b T C 2: 27,112,862 E41G possibly damaging Het
Fam180a A C 6: 35,315,352 S40A probably benign Het
Fbxl4 T C 4: 22,385,950 S186P probably benign Het
Fbxw19 A T 9: 109,494,772 L45* probably null Het
Fgf14 G T 14: 124,676,512 T69N probably benign Het
Flt1 A G 5: 147,672,709 Y432H probably damaging Het
Frmd4b A T 6: 97,306,764 L374Q possibly damaging Het
G6pc2 T A 2: 69,222,977 V125D probably damaging Het
Gna15 A T 10: 81,512,120 L164Q probably damaging Het
Gnaz C A 10: 74,991,870 D151E possibly damaging Het
Has1 T C 17: 17,850,300 T120A probably benign Het
Hectd4 T A 5: 121,358,303 D3919E possibly damaging Het
Hs3st5 A G 10: 36,833,169 I233M probably benign Het
Ilf3 T C 9: 21,403,142 probably benign Het
Inpp5b T A 4: 124,793,276 L765* probably null Het
Insr A T 8: 3,159,561 I1174N probably damaging Het
Kcnq3 A G 15: 66,005,906 L445P probably damaging Het
Kctd20 A T 17: 28,962,850 N159Y probably damaging Het
Kctd20 A T 17: 28,966,781 D366V probably damaging Het
Klk15 T C 7: 43,938,333 probably benign Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mas1 T C 17: 12,841,699 Y279C probably damaging Het
Mast2 G T 4: 116,306,959 D1747E probably damaging Het
Mest G A 6: 30,745,139 M235I probably benign Het
Mfsd6 A G 1: 52,660,805 probably null Het
Mllt10 T A 2: 18,162,846 S449R probably damaging Het
Mon2 T A 10: 123,013,763 T1211S probably benign Het
Mrnip G A 11: 50,176,861 C27Y probably damaging Het
Myh15 A T 16: 49,163,135 T1538S probably benign Het
Nfatc2ip A G 7: 126,390,462 V250A probably benign Het
Npy1r A G 8: 66,704,525 D199G possibly damaging Het
Numbl A G 7: 27,280,954 T454A probably benign Het
Nutm2 T G 13: 50,473,116 F436V probably damaging Het
Olfr1112 T A 2: 87,191,698 S4T probably benign Het
Olfr330 A G 11: 58,529,776 L70P probably damaging Het
Olfr458 A G 6: 42,460,677 L114S probably damaging Het
Olfr556 A G 7: 102,670,301 Y127C probably damaging Het
Olfr631 C T 7: 103,929,725 R301* probably null Het
Olfr64 A G 7: 103,893,277 S153P probably benign Het
Olfr676 A G 7: 105,035,950 S251G probably benign Het
Olfr707 A T 7: 106,891,977 probably null Het
Olfr707 G T 7: 106,891,978 L44M probably damaging Het
Olfr876 T A 9: 37,804,303 Y131N probably damaging Het
Opa1 T C 16: 29,620,810 S773P probably benign Het
Pde8a G C 7: 81,300,723 probably null Het
Pgam1 T C 19: 41,917,705 F232S probably damaging Het
Pgk1 T A X: 106,200,308 V303E possibly damaging Het
Pirb A T 7: 3,717,190 C395S probably damaging Het
Plxnc1 C T 10: 94,844,322 V824I probably benign Het
Ppp6r1 A G 7: 4,633,692 probably null Het
Rapgef4 C A 2: 72,225,787 probably benign Het
Rars T A 11: 35,809,638 T539S probably damaging Het
Rbm44 G T 1: 91,153,957 probably null Het
RP23-114B10.6 T C 8: 69,373,558 I119M unknown Het
Samd4b A G 7: 28,413,892 I216T probably benign Het
Serpine2 A C 1: 79,816,815 F134V probably damaging Het
Shmt1 A G 11: 60,792,964 Y341H probably damaging Het
Slc23a2 C A 2: 132,075,641 V226F probably benign Het
Slc23a4 A G 6: 34,956,961 I69T probably damaging Het
Slc37a1 C A 17: 31,333,678 T319K possibly damaging Het
Slc6a4 A T 11: 77,013,252 T178S probably damaging Het
Smarca4 G A 9: 21,701,183 A1588T possibly damaging Het
Spag17 A T 3: 100,027,352 Y650F possibly damaging Het
Stab2 C T 10: 87,003,008 G65S probably damaging Het
Stambpl1 C G 19: 34,226,721 N70K probably damaging Het
Stip1 C A 19: 7,021,797 C471F probably damaging Het
Taf1 T C X: 101,540,894 S223P probably benign Het
Tchh C A 3: 93,443,575 N107K possibly damaging Het
Tenm3 A C 8: 48,232,104 H2432Q probably damaging Het
Tmem243 A G 5: 9,118,548 N110S probably damaging Het
Toe1 A T 4: 116,804,879 I306F probably benign Het
Trank1 G A 9: 111,392,927 V2911M probably damaging Het
Trpm4 A G 7: 45,308,612 I811T probably damaging Het
Tspear T A 10: 77,875,116 probably null Het
Ttc28 A T 5: 111,277,168 I1589F possibly damaging Het
Tubgcp3 A G 8: 12,649,686 probably benign Het
U2af2 C A 7: 5,067,545 R78S probably benign Het
Wdr17 A T 8: 54,673,654 D388E possibly damaging Het
Wdr3 A T 3: 100,153,870 S261T probably benign Het
Zfp667 A G 7: 6,305,067 N245D possibly damaging Het
Zfp692 A G 11: 58,310,176 probably benign Het
Zfp729a T C 13: 67,619,251 H953R probably benign Het
Other mutations in Lama4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Lama4 APN 10 39065595 splice site probably benign
IGL00091:Lama4 APN 10 39072805 missense probably damaging 1.00
IGL00429:Lama4 APN 10 39011026 missense possibly damaging 0.58
IGL00430:Lama4 APN 10 39045704 missense possibly damaging 0.54
IGL01074:Lama4 APN 10 39098488 critical splice donor site probably null
IGL01386:Lama4 APN 10 39011064 missense probably benign 0.00
IGL01603:Lama4 APN 10 39065646 missense possibly damaging 0.92
IGL01643:Lama4 APN 10 39056850 missense probably benign
IGL01655:Lama4 APN 10 39060213 missense probably benign
IGL01954:Lama4 APN 10 39087299 missense probably benign 0.05
IGL01984:Lama4 APN 10 39075529 critical splice donor site probably null
IGL02193:Lama4 APN 10 39042674 missense probably benign
IGL02290:Lama4 APN 10 39017364 missense probably benign 0.00
IGL02441:Lama4 APN 10 39061445 missense probably benign 0.20
IGL02549:Lama4 APN 10 39060204 missense probably benign 0.00
IGL02797:Lama4 APN 10 39056924 missense probably null 0.00
IGL02819:Lama4 APN 10 39026569 missense possibly damaging 0.80
IGL03122:Lama4 APN 10 39067963 missense probably benign
IGL03184:Lama4 APN 10 39078843 missense probably damaging 1.00
IGL03307:Lama4 APN 10 39017383 missense probably benign
BB006:Lama4 UTSW 10 39078847 missense probably damaging 1.00
BB016:Lama4 UTSW 10 39078847 missense probably damaging 1.00
PIT4585001:Lama4 UTSW 10 39074746 missense probably damaging 1.00
R0003:Lama4 UTSW 10 39060222 missense possibly damaging 0.55
R0015:Lama4 UTSW 10 39075436 missense possibly damaging 0.87
R0015:Lama4 UTSW 10 39075436 missense possibly damaging 0.87
R0035:Lama4 UTSW 10 39072738 missense probably benign 0.01
R0141:Lama4 UTSW 10 39092278 missense probably benign 0.05
R0257:Lama4 UTSW 10 39094884 splice site probably benign
R0267:Lama4 UTSW 10 39028639 missense probably damaging 0.96
R0557:Lama4 UTSW 10 39088397 missense probably benign 0.38
R1052:Lama4 UTSW 10 39092245 missense possibly damaging 0.68
R1248:Lama4 UTSW 10 39056847 missense probably damaging 0.99
R1249:Lama4 UTSW 10 39075478 missense probably damaging 1.00
R1291:Lama4 UTSW 10 39048069 missense probably benign 0.00
R1307:Lama4 UTSW 10 39070032 missense probably benign 0.06
R1404:Lama4 UTSW 10 39061391 missense probably benign 0.09
R1404:Lama4 UTSW 10 39061391 missense probably benign 0.09
R1443:Lama4 UTSW 10 39073643 missense probably damaging 1.00
R1499:Lama4 UTSW 10 39088880 missense possibly damaging 0.92
R1616:Lama4 UTSW 10 39075450 missense probably damaging 1.00
R1691:Lama4 UTSW 10 39080563 missense probably benign 0.09
R1748:Lama4 UTSW 10 39065619 missense probably benign 0.01
R1772:Lama4 UTSW 10 39060224 missense probably benign 0.00
R1813:Lama4 UTSW 10 39033125 splice site probably benign
R1813:Lama4 UTSW 10 39060186 missense probably damaging 1.00
R1897:Lama4 UTSW 10 39060186 missense probably damaging 1.00
R1907:Lama4 UTSW 10 39072758 missense probably benign 0.13
R1943:Lama4 UTSW 10 39097138 missense possibly damaging 0.85
R2041:Lama4 UTSW 10 39069991 missense probably damaging 1.00
R2242:Lama4 UTSW 10 39026693 missense probably damaging 1.00
R2300:Lama4 UTSW 10 39087320 missense probably benign
R2326:Lama4 UTSW 10 39042567 splice site probably null
R2570:Lama4 UTSW 10 39075358 missense possibly damaging 0.94
R2570:Lama4 UTSW 10 39106047 missense probably damaging 1.00
R2571:Lama4 UTSW 10 39042675 missense possibly damaging 0.55
R2887:Lama4 UTSW 10 39092254 missense possibly damaging 0.94
R2926:Lama4 UTSW 10 39078832 missense probably benign 0.16
R3237:Lama4 UTSW 10 39097179 missense probably damaging 0.97
R4095:Lama4 UTSW 10 39097122 missense probably damaging 1.00
R4151:Lama4 UTSW 10 39005428 missense probably benign 0.00
R4470:Lama4 UTSW 10 39080496 nonsense probably null
R4812:Lama4 UTSW 10 39072769 missense probably benign
R4822:Lama4 UTSW 10 39033053 missense probably benign 0.01
R4997:Lama4 UTSW 10 39092266 missense probably damaging 0.99
R5119:Lama4 UTSW 10 39048054 missense probably benign 0.00
R5468:Lama4 UTSW 10 39072682 splice site probably null
R5909:Lama4 UTSW 10 39072859 missense probably benign 0.00
R5917:Lama4 UTSW 10 39048032 missense probably benign 0.10
R5927:Lama4 UTSW 10 39072812 missense probably damaging 1.00
R5950:Lama4 UTSW 10 39030448 missense probably benign 0.03
R6051:Lama4 UTSW 10 39067902 missense probably benign 0.01
R6277:Lama4 UTSW 10 39106010 missense probably damaging 1.00
R6294:Lama4 UTSW 10 39075470 missense probably damaging 1.00
R6372:Lama4 UTSW 10 39067952 missense probably benign
R6532:Lama4 UTSW 10 39048077 missense possibly damaging 0.58
R6547:Lama4 UTSW 10 39073656 missense probably damaging 1.00
R6578:Lama4 UTSW 10 39017365 missense probably benign 0.01
R6737:Lama4 UTSW 10 39094911 missense probably damaging 0.96
R6987:Lama4 UTSW 10 39074279 missense probably benign 0.00
R7040:Lama4 UTSW 10 39060162 missense possibly damaging 0.69
R7139:Lama4 UTSW 10 39075495 missense probably damaging 1.00
R7188:Lama4 UTSW 10 38965733 start gained probably benign
R7189:Lama4 UTSW 10 38965733 start gained probably benign
R7199:Lama4 UTSW 10 39080540 missense possibly damaging 0.84
R7211:Lama4 UTSW 10 39005495 missense probably damaging 0.98
R7262:Lama4 UTSW 10 39094934 missense probably damaging 1.00
R7274:Lama4 UTSW 10 39092299 missense probably benign 0.00
R7311:Lama4 UTSW 10 39026635 missense probably damaging 1.00
R7391:Lama4 UTSW 10 39087387 critical splice donor site probably null
R7399:Lama4 UTSW 10 39047948 missense probably damaging 0.98
R7426:Lama4 UTSW 10 39045755 missense possibly damaging 0.82
R7472:Lama4 UTSW 10 39087373 missense possibly damaging 0.65
R7635:Lama4 UTSW 10 39092188 missense probably benign
R7775:Lama4 UTSW 10 39078847 missense probably damaging 1.00
R7805:Lama4 UTSW 10 39026751 critical splice donor site probably null
R7885:Lama4 UTSW 10 39088844 missense probably benign 0.01
R7895:Lama4 UTSW 10 39088329 missense probably damaging 0.96
R7910:Lama4 UTSW 10 39070009 missense probably damaging 0.99
R7929:Lama4 UTSW 10 39078847 missense probably damaging 1.00
R7952:Lama4 UTSW 10 39030490 missense probably benign 0.39
R7991:Lama4 UTSW 10 39045809 missense possibly damaging 0.70
R8059:Lama4 UTSW 10 38966061 missense probably benign 0.00
R8194:Lama4 UTSW 10 39078720 missense probably damaging 0.99
R8248:Lama4 UTSW 10 39061379 missense possibly damaging 0.82
R8252:Lama4 UTSW 10 39060146 missense probably benign 0.00
R8265:Lama4 UTSW 10 39105204 missense probably damaging 1.00
R8275:Lama4 UTSW 10 39072811 missense probably damaging 1.00
R8426:Lama4 UTSW 10 39103491 missense probably damaging 0.98
R8434:Lama4 UTSW 10 39026707 missense possibly damaging 0.92
R8720:Lama4 UTSW 10 39095083 missense probably damaging 0.97
R8792:Lama4 UTSW 10 39048052 missense probably benign 0.00
R8836:Lama4 UTSW 10 39026591 missense probably damaging 1.00
R8867:Lama4 UTSW 10 39048000 missense probably damaging 1.00
R8892:Lama4 UTSW 10 39097198 missense probably damaging 1.00
R8913:Lama4 UTSW 10 39106043 missense probably benign 0.10
R9129:Lama4 UTSW 10 39056891 missense probably benign
R9177:Lama4 UTSW 10 39074692 missense probably damaging 0.98
R9187:Lama4 UTSW 10 39048128 critical splice donor site probably null
R9193:Lama4 UTSW 10 39075448 missense probably benign 0.03
R9268:Lama4 UTSW 10 39074692 missense probably damaging 0.98
R9287:Lama4 UTSW 10 39105964 missense probably damaging 1.00
R9295:Lama4 UTSW 10 39072751 missense probably damaging 1.00
R9303:Lama4 UTSW 10 39097141 missense probably damaging 0.99
R9330:Lama4 UTSW 10 39078726 missense probably damaging 0.99
R9430:Lama4 UTSW 10 39045806 missense probably null
X0067:Lama4 UTSW 10 39045692 missense probably benign 0.00
Z1177:Lama4 UTSW 10 39005424 nonsense probably null
Z1177:Lama4 UTSW 10 39005425 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTCTCTTAAAGTCGTAAATGGAGCTG -3'
(R):5'- TGTGAACACACGCATTGCACAC -3'

Sequencing Primer
(F):5'- CTGAAGGCTGGAACGCTAC -3'
(R):5'- TGCTGTGAAACACACGTCTG -3'
Posted On 2014-05-23