Incidental Mutation 'R7399:Lama4'

• ID: 574042
• Institutional Source: Beutler Lab
• Gene Symbol: Lama4
• Ensembl Gene: ENSMUSG00000019846
• Gene Name: laminin, alpha 4
• Synonyms: laminin [a]4
• MMRRC Submission: 045481-MU
• Essential gene?: Essential (E-score: 1.000)
• Stock #: R7399 (G1)
• Quality Score: 225.009
• Status: Validated
• Chromosome: 10
• Chromosomal Location: 38965515-39110188 bp(+) (GRCm38)
• Type of Mutation: missense
• DNA Base Change (assembly): G to A at 39047948 bp (GRCm38)
• Zygosity: Heterozygous
• Amino Acid Change: Glutamic Acid to Lysine at position 451 (E451K)
• Ref Sequence: ENSEMBL: ENSMUSP00000019992
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000019992]
• AlphaFold: P97927
• Predicted Effect: probably damaging; Transcript: ENSMUST00000019992; AA Change: E451K; PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
• SMART Domains: Protein: ENSMUSP00000019992; Gene: ENSMUSG00000019846; AA Change: E451K

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
EGF_Lam	82	129	1.95e-8	SMART
EGF_Lam	132	184	5.78e-11	SMART
EGF_Lam	187	238	9.83e-14	SMART
Pfam:Laminin_I	283	548	5.3e-71	PFAM
coiled coil region	658	685	N/A	INTRINSIC
LamG	850	1009	9.54e-11	SMART
LamG	1066	1205	5.9e-25	SMART
LamG	1250	1374	6.68e-24	SMART
LamG	1484	1619	1.54e-37	SMART
LamG	1661	1794	3.63e-34	SMART

• Coding Region Coverage:
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
• Validation Efficiency: 99% (74/75)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the alpha chain isoform laminin, alpha 4. The domain structure of alpha 4 is similar to that of alpha 3, both of which resemble truncated versions of alpha 1 and alpha 2, in that approximately 1,200 residues at the N-terminus (domains IV, V and VI) have been lost. Laminin, alpha 4 contains the C-terminal G domain which distinguishes all alpha chains from the beta and gamma chains. The RNA analysis from adult and fetal tissues revealed developmental regulation of expression, however, the exact function of laminin, alpha 4 is not known. Tissue-specific utilization of alternative polyA-signal has been described in literature. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2011] ; PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired motor control of the hind limbs associated with improperly positioned synaptic active zones and junctional folds, and prenatal and neonatal hemorrhages associated with capillary defects. [provided by MGI curators]
• Posted On: 2019-09-13

Predicted Primers

PCR Primer
(F):5'- AGGAGTTCCTAAATCCAGCAGG -3'
(R):5'- ATGCCTGACATGCGTTCAC -3'

Sequencing Primer
(F):5'- GGAAAGCATCTCTCCCTTAACTGG -3'
(R):5'- GACATGCGTTCACAGTTGC -3'