Incidental Mutation 'R0090:Itgb8'
ID20167
Institutional Source Beutler Lab
Gene Symbol Itgb8
Ensembl Gene ENSMUSG00000025321
Gene Nameintegrin beta 8
Synonyms4832412O06Rik
MMRRC Submission 038377-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0090 (G1)
Quality Score225
Status Validated (trace)
Chromosome12
Chromosomal Location119158022-119238802 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119202563 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 78 (S78P)
Ref Sequence ENSEMBL: ENSMUSP00000026360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026360]
Predicted Effect probably benign
Transcript: ENSMUST00000026360
AA Change: S78P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000026360
Gene: ENSMUSG00000025321
AA Change: S78P

DomainStartEndE-ValueType
Blast:INB 1 44 9e-8 BLAST
PSI 46 95 6.65e-9 SMART
INB 54 469 4.31e-237 SMART
VWA 146 352 2.15e-1 SMART
Blast:INB 494 532 9e-12 BLAST
EGF 551 583 1.53e1 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151023
Meta Mutation Damage Score 0.0680 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.7%
  • 20x: 91.4%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the integrin beta chain family and encodes a single-pass type I membrane protein with a VWFA domain and four cysteine-rich repeats. This protein noncovalently binds to an alpha subunit to form a heterodimeric integrin complex. In general, integrin complexes mediate cell-cell and cell-extracellular matrix interactions and this complex plays a role in human airway epithelial proliferation. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene either die before E11.5 as a result of circulatory abnormalities in the placenta or die within the first for days after birth and display intracerebral hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
4933427I04Rik A G 4: 123,860,982 T230A possibly damaging Het
9230110C19Rik T A 9: 8,027,183 N118I probably benign Het
Acsm1 T C 7: 119,662,189 probably benign Het
Acta1 T C 8: 123,893,657 N14S probably damaging Het
Aff4 A G 11: 53,392,782 T362A probably benign Het
Aggf1 A G 13: 95,364,959 I305T probably benign Het
Ap4b1 A G 3: 103,820,429 D325G possibly damaging Het
Ap4e1 C T 2: 127,064,985 T1055I possibly damaging Het
Arhgef2 A T 3: 88,639,348 Q496L probably damaging Het
Arhgef28 A G 13: 98,075,110 F122L probably damaging Het
Baiap3 G A 17: 25,250,070 probably benign Het
Casp8ap2 T A 4: 32,640,327 H460Q probably damaging Het
Casz1 A G 4: 148,933,411 T386A probably benign Het
Cd53 A T 3: 106,767,409 V114E possibly damaging Het
Celsr2 A G 3: 108,393,327 probably benign Het
Chaf1b G T 16: 93,887,124 A88S possibly damaging Het
Cldn10 A T 14: 118,874,200 Y194F probably damaging Het
Clec2e A C 6: 129,095,218 probably null Het
Cmpk2 A T 12: 26,478,022 T413S probably benign Het
Col9a1 T A 1: 24,223,562 probably null Het
Dchs1 G T 7: 105,755,932 Q2468K probably benign Het
Ddx60 A G 8: 61,942,293 D88G probably damaging Het
Dnah8 A G 17: 30,784,090 R3588G probably benign Het
Ect2 C T 3: 27,138,502 E431K probably null Het
Ect2 T C 3: 27,115,476 T774A probably benign Het
Ern1 A G 11: 106,405,823 V767A probably damaging Het
Fbln1 A C 15: 85,224,288 E75A possibly damaging Het
Fgf5 C T 5: 98,261,987 R132* probably null Het
Folh1 T C 7: 86,725,868 probably benign Het
Gdf15 A T 8: 70,629,684 H257Q probably damaging Het
Ghitm T C 14: 37,122,219 T322A probably benign Het
Gm13212 A T 4: 145,622,625 K211* probably null Het
Gm5709 A G 3: 59,618,771 noncoding transcript Het
Hbb-y C T 7: 103,852,743 probably null Het
Hmcn2 A T 2: 31,426,198 D3771V probably damaging Het
Hspa12a T C 19: 58,799,509 D627G probably benign Het
Idh2 T C 7: 80,097,914 E286G probably damaging Het
Idh3b C A 2: 130,280,979 A297S probably benign Het
Igsf3 A G 3: 101,435,652 E535G probably damaging Het
Ilf3 T A 9: 21,395,414 D314E probably damaging Het
Itih5 G A 2: 10,164,684 V31I probably benign Het
Kcnj2 T C 11: 111,073,027 V415A probably benign Het
Kin A G 2: 10,085,773 Q53R possibly damaging Het
Krt78 A T 15: 101,947,837 M513K probably benign Het
Krtap4-8 A T 11: 99,780,486 probably benign Het
Ltbr T C 6: 125,309,449 probably benign Het
Mgat4a G A 1: 37,490,333 T146I probably damaging Het
Mrps2 G C 2: 28,468,256 W19C probably damaging Het
Mthfs T C 9: 89,211,291 S33P probably damaging Het
Myh6 T C 14: 54,958,704 D546G probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Ndst2 T C 14: 20,727,267 T553A probably damaging Het
Nlrp12 T C 7: 3,240,034 E616G probably damaging Het
Nrde2 T C 12: 100,129,286 probably benign Het
Nup210l G A 3: 90,211,779 V1832I probably benign Het
Olfr1283 A T 2: 111,369,294 I221F probably damaging Het
Olfr376 G A 11: 73,375,576 V276I probably benign Het
Pcm1 A T 8: 41,256,041 E9D probably damaging Het
Pear1 A T 3: 87,754,342 D541E possibly damaging Het
Peg10 A G 6: 4,756,063 probably benign Het
Prss1 G A 6: 41,461,232 R31Q probably benign Het
Ptpn13 T C 5: 103,569,503 V1837A probably damaging Het
Rasgrp3 A G 17: 75,498,461 D149G probably damaging Het
Reg3d A T 6: 78,378,483 H8Q possibly damaging Het
Rhox4f A C X: 37,607,469 V15G probably benign Het
Sacs T A 14: 61,205,440 L1645H probably damaging Het
Slc16a5 A T 11: 115,464,925 S71C probably damaging Het
Slc9a3 A G 13: 74,158,728 E324G probably damaging Het
Smgc T C 15: 91,859,762 V574A possibly damaging Het
Stac3 C T 10: 127,503,930 probably benign Het
Supv3l1 A G 10: 62,429,706 L685P probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tas2r125 G T 6: 132,910,398 A250S probably benign Het
Tdrd6 C T 17: 43,628,241 V639I probably benign Het
Thap12 T G 7: 98,715,893 W423G probably damaging Het
Tmem245 T C 4: 56,899,410 I217V probably benign Het
Trip12 T A 1: 84,732,136 probably benign Het
Tshz3 T C 7: 36,768,892 V102A probably benign Het
Ubap1 T C 4: 41,379,826 S347P probably damaging Het
Usp10 C T 8: 119,953,196 Q612* probably null Het
Vmn2r72 T C 7: 85,754,876 I36V probably benign Het
Vps37a T C 8: 40,526,989 I63T possibly damaging Het
Whrn C A 4: 63,432,732 R9L possibly damaging Het
Xrcc1 T C 7: 24,570,217 Y401H probably damaging Het
Ylpm1 GCCTAAGCAGCAACCTAAG GCCTAAG 12: 85,029,040 probably benign Het
Zfhx3 G A 8: 108,950,057 D2580N possibly damaging Het
Zfhx4 A G 3: 5,243,625 N637S probably damaging Het
Zyg11a A T 4: 108,201,347 probably benign Het
Other mutations in Itgb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Itgb8 APN 12 119189826 missense probably damaging 0.99
IGL01859:Itgb8 APN 12 119189945 missense probably damaging 1.00
IGL02555:Itgb8 APN 12 119189881 missense probably damaging 1.00
IGL02665:Itgb8 APN 12 119166865 splice site probably benign
IGL02732:Itgb8 APN 12 119163353 missense probably benign 0.09
R0245:Itgb8 UTSW 12 119190555 missense probably damaging 1.00
R0629:Itgb8 UTSW 12 119202481 missense probably benign 0.38
R1158:Itgb8 UTSW 12 119202496 missense probably damaging 1.00
R1355:Itgb8 UTSW 12 119171003 missense probably benign 0.03
R1370:Itgb8 UTSW 12 119171003 missense probably benign 0.03
R1604:Itgb8 UTSW 12 119202530 missense probably damaging 1.00
R1689:Itgb8 UTSW 12 119170820 missense probably benign 0.38
R1782:Itgb8 UTSW 12 119192118 missense probably damaging 0.99
R1789:Itgb8 UTSW 12 119202455 missense probably benign
R2113:Itgb8 UTSW 12 119190612 missense probably damaging 1.00
R2301:Itgb8 UTSW 12 119202455 missense probably benign
R3696:Itgb8 UTSW 12 119177011 missense probably damaging 0.99
R3797:Itgb8 UTSW 12 119163469 missense possibly damaging 0.92
R3911:Itgb8 UTSW 12 119168005 missense possibly damaging 0.65
R4904:Itgb8 UTSW 12 119170871 missense probably benign 0.00
R5391:Itgb8 UTSW 12 119170741 missense probably damaging 1.00
R5395:Itgb8 UTSW 12 119170741 missense probably damaging 1.00
R5444:Itgb8 UTSW 12 119237838 utr 5 prime probably benign
R5461:Itgb8 UTSW 12 119168005 missense probably benign 0.28
R5610:Itgb8 UTSW 12 119170694 missense probably damaging 1.00
R5669:Itgb8 UTSW 12 119190628 missense probably damaging 1.00
R5877:Itgb8 UTSW 12 119202536 missense probably benign 0.37
R6581:Itgb8 UTSW 12 119163215 missense probably benign 0.41
R6597:Itgb8 UTSW 12 119173398 missense possibly damaging 0.94
R6631:Itgb8 UTSW 12 119180977 nonsense probably null
R6971:Itgb8 UTSW 12 119190631 missense probably damaging 1.00
R7124:Itgb8 UTSW 12 119202424 nonsense probably null
R7246:Itgb8 UTSW 12 119168050 missense probably damaging 1.00
R7282:Itgb8 UTSW 12 119237708 missense probably benign 0.00
R7299:Itgb8 UTSW 12 119202461 missense probably benign 0.00
R7340:Itgb8 UTSW 12 119192204 missense probably benign 0.45
R7373:Itgb8 UTSW 12 119202475 missense probably benign 0.01
R7766:Itgb8 UTSW 12 119163359 missense probably damaging 1.00
R7855:Itgb8 UTSW 12 119166772 missense probably benign
R8195:Itgb8 UTSW 12 119168170 missense probably damaging 1.00
R8354:Itgb8 UTSW 12 119170778 missense probably benign 0.01
R8454:Itgb8 UTSW 12 119170778 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCAGTTGGACTGAGACTTCTCCC -3'
(R):5'- GGAGTTGTTCTCATCTCCCAAGCAC -3'

Sequencing Primer
(F):5'- GAGACTTCTCCCGGTGTCAC -3'
(R):5'- GTTGTCACAGAGGTGATTTGCTA -3'
Posted On2013-04-11