Incidental Mutation 'R8454:Itgb8'
ID654950
Institutional Source Beutler Lab
Gene Symbol Itgb8
Ensembl Gene ENSMUSG00000025321
Gene Nameintegrin beta 8
Synonyms4832412O06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8454 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location119158022-119238802 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119170778 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 518 (V518D)
Ref Sequence ENSEMBL: ENSMUSP00000026360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026360]
Predicted Effect probably benign
Transcript: ENSMUST00000026360
AA Change: V518D

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000026360
Gene: ENSMUSG00000025321
AA Change: V518D

DomainStartEndE-ValueType
Blast:INB 1 44 9e-8 BLAST
PSI 46 95 6.65e-9 SMART
INB 54 469 4.31e-237 SMART
VWA 146 352 2.15e-1 SMART
Blast:INB 494 532 9e-12 BLAST
EGF 551 583 1.53e1 SMART
transmembrane domain 680 702 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the integrin beta chain family and encodes a single-pass type I membrane protein with a VWFA domain and four cysteine-rich repeats. This protein noncovalently binds to an alpha subunit to form a heterodimeric integrin complex. In general, integrin complexes mediate cell-cell and cell-extracellular matrix interactions and this complex plays a role in human airway epithelial proliferation. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene either die before E11.5 as a result of circulatory abnormalities in the placenta or die within the first for days after birth and display intracerebral hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,792,572 F493Y probably benign Het
Abcc10 C A 17: 46,324,177 G300V possibly damaging Het
Adgrg7 C G 16: 56,795,682 probably benign Het
Agt G A 8: 124,564,103 T155M probably benign Het
Atp8b3 A G 10: 80,525,799 V763A probably benign Het
Btn1a1 C A 13: 23,464,250 V138L probably benign Het
Cd163 A T 6: 124,328,965 N1109I probably benign Het
Cideb T A 14: 55,755,141 Q106L possibly damaging Het
Cntn1 A G 15: 92,232,249 T126A probably benign Het
Dusp27 A T 1: 166,108,133 N165K probably damaging Het
Elfn1 T C 5: 139,971,471 Y77H probably damaging Het
Eml3 A G 19: 8,934,994 H386R probably damaging Het
Fbxo21 A G 5: 117,995,414 D413G probably damaging Het
Fkbp8 T A 8: 70,531,763 probably null Het
Fzd1 T C 5: 4,757,336 Q82R probably benign Het
Gast T C 11: 100,336,568 L29P probably benign Het
Glb1l2 C A 9: 26,806,417 probably benign Het
Gm1110 C G 9: 26,883,280 Q483H probably benign Het
Gm1110 T A 9: 26,883,281 Q483L probably benign Het
Gm5737 T A 7: 120,831,180 V420E possibly damaging Het
Gpc6 T C 14: 116,925,979 L15P probably damaging Het
Hagh C A 17: 24,857,562 S161* probably null Het
Hrh1 A G 6: 114,480,853 D365G probably benign Het
Ighv1-36 A T 12: 114,879,940 M100K probably damaging Het
Krt82 T C 15: 101,541,803 Y486C probably damaging Het
Lmbr1l A G 15: 98,912,476 S85P probably damaging Het
Met A G 6: 17,491,769 S177G probably damaging Het
Myl9 T A 2: 156,781,128 I162N possibly damaging Het
Npat T A 9: 53,566,951 N973K possibly damaging Het
Olfr493 A T 7: 108,346,682 C100S probably damaging Het
Pcdhga12 A T 18: 37,768,137 D674V possibly damaging Het
Phtf1 T A 3: 104,004,449 N702K probably damaging Het
Plaa A T 4: 94,569,477 I752N probably damaging Het
Pnpla2 T C 7: 141,458,098 C194R probably damaging Het
Rnaseh2a T C 8: 84,965,147 N133S probably benign Het
Rps6ka1 T A 4: 133,848,553 Q685L probably benign Het
Ryr1 C A 7: 29,015,717 G4661C unknown Het
Samd13 T A 3: 146,646,402 M65L probably benign Het
Sec22c A G 9: 121,695,655 S21P probably damaging Het
Sh3d19 C A 3: 86,107,022 T431K probably benign Het
Sin3b A G 8: 72,741,480 M277V probably benign Het
Sis T C 3: 72,947,501 T468A possibly damaging Het
Slitrk3 T C 3: 73,049,180 N753S probably benign Het
Slitrk6 C A 14: 110,752,046 L76F probably damaging Het
Stk3 C T 15: 34,876,724 A478T probably damaging Het
Sugp1 C A 8: 70,071,597 Y617* probably null Het
Tinag T C 9: 77,031,695 D167G probably damaging Het
Tk2 A G 8: 104,241,114 probably null Het
Tmem209 A T 6: 30,489,309 V514D probably damaging Het
Tmprss9 A G 10: 80,887,486 H260R probably benign Het
Tnfrsf14 T A 4: 154,926,655 Y83F possibly damaging Het
Tnfrsf8 A T 4: 145,287,983 D285E probably benign Het
Togaram2 C G 17: 71,697,878 A310G probably benign Het
Trpv3 A G 11: 73,291,622 Y544C probably damaging Het
Ttl T A 2: 129,066,184 V13D probably damaging Het
Usp40 A T 1: 87,980,972 D602E probably benign Het
Vamp5 A G 6: 72,370,393 probably benign Het
Vmn2r65 T A 7: 84,940,194 H838L possibly damaging Het
Wdr63 T C 3: 146,097,227 K70E probably damaging Het
Zfp960 T A 17: 17,088,199 Y392N probably benign Het
Other mutations in Itgb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Itgb8 APN 12 119189826 missense probably damaging 0.99
IGL01859:Itgb8 APN 12 119189945 missense probably damaging 1.00
IGL02555:Itgb8 APN 12 119189881 missense probably damaging 1.00
IGL02665:Itgb8 APN 12 119166865 splice site probably benign
IGL02732:Itgb8 APN 12 119163353 missense probably benign 0.09
R0090:Itgb8 UTSW 12 119202563 missense probably benign 0.00
R0245:Itgb8 UTSW 12 119190555 missense probably damaging 1.00
R0629:Itgb8 UTSW 12 119202481 missense probably benign 0.38
R1158:Itgb8 UTSW 12 119202496 missense probably damaging 1.00
R1355:Itgb8 UTSW 12 119171003 missense probably benign 0.03
R1370:Itgb8 UTSW 12 119171003 missense probably benign 0.03
R1604:Itgb8 UTSW 12 119202530 missense probably damaging 1.00
R1689:Itgb8 UTSW 12 119170820 missense probably benign 0.38
R1782:Itgb8 UTSW 12 119192118 missense probably damaging 0.99
R1789:Itgb8 UTSW 12 119202455 missense probably benign
R2113:Itgb8 UTSW 12 119190612 missense probably damaging 1.00
R2301:Itgb8 UTSW 12 119202455 missense probably benign
R3696:Itgb8 UTSW 12 119177011 missense probably damaging 0.99
R3797:Itgb8 UTSW 12 119163469 missense possibly damaging 0.92
R3911:Itgb8 UTSW 12 119168005 missense possibly damaging 0.65
R4904:Itgb8 UTSW 12 119170871 missense probably benign 0.00
R5391:Itgb8 UTSW 12 119170741 missense probably damaging 1.00
R5395:Itgb8 UTSW 12 119170741 missense probably damaging 1.00
R5444:Itgb8 UTSW 12 119237838 utr 5 prime probably benign
R5461:Itgb8 UTSW 12 119168005 missense probably benign 0.28
R5610:Itgb8 UTSW 12 119170694 missense probably damaging 1.00
R5669:Itgb8 UTSW 12 119190628 missense probably damaging 1.00
R5877:Itgb8 UTSW 12 119202536 missense probably benign 0.37
R6581:Itgb8 UTSW 12 119163215 missense probably benign 0.41
R6597:Itgb8 UTSW 12 119173398 missense possibly damaging 0.94
R6631:Itgb8 UTSW 12 119180977 nonsense probably null
R6971:Itgb8 UTSW 12 119190631 missense probably damaging 1.00
R7124:Itgb8 UTSW 12 119202424 nonsense probably null
R7246:Itgb8 UTSW 12 119168050 missense probably damaging 1.00
R7282:Itgb8 UTSW 12 119237708 missense probably benign 0.00
R7299:Itgb8 UTSW 12 119202461 missense probably benign 0.00
R7340:Itgb8 UTSW 12 119192204 missense probably benign 0.45
R7373:Itgb8 UTSW 12 119202475 missense probably benign 0.01
R7766:Itgb8 UTSW 12 119163359 missense probably damaging 1.00
R7855:Itgb8 UTSW 12 119166772 missense probably benign
R8195:Itgb8 UTSW 12 119168170 missense probably damaging 1.00
R8354:Itgb8 UTSW 12 119170778 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGGGTTAAGTGGCAGTACC -3'
(R):5'- CATACACAGAAGCTGCAGTTG -3'

Sequencing Primer
(F):5'- GGTTAAGTGGCAGTACCTCATCAC -3'
(R):5'- TTGCCAGTGTGAGAACCAC -3'
Posted On2020-10-20