Mutagenetix > Incidental Mutation

Incidental Mutation 'R1832:Lamc2'

204832

Institutional Source

Beutler Lab

Gene Symbol

Lamc2

Ensembl Gene

ENSMUSG00000026479

Gene Name

laminin, gamma 2

Synonyms

nicein, 100kDa

MMRRC Submission

039859-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.601) question?

Stock #

R1832 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

153122756-153186447 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 153166187 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 67 (R67Q)

Ref Sequence

ENSEMBL: ENSMUSP00000140514 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027753] [ENSMUST00000185356]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027753
AA Change: R67Q

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000027753
Gene: ENSMUSG00000026479
AA Change: R67Q

Domain	Start	End	E-Value	Type
EGF_Lam	28	81	1.03e-7	SMART
EGF_Lam	84	128	2.14e-14	SMART
EGF_Lam	139	184	4.52e-13	SMART
LamB	245	370	7.58e-46	SMART
EGF_like	370	413	3.83e0	SMART
Blast:EGF_like	417	460	8e-23	BLAST
EGF_Lam	462	514	1.95e-8	SMART
EGF_Lam	517	570	1.88e-10	SMART
EGF_like	573	610	2.6e-1	SMART
coiled coil region	612	680	N/A	INTRINSIC
low complexity region	792	817	N/A	INTRINSIC
coiled coil region	952	994	N/A	INTRINSIC
low complexity region	1016	1027	N/A	INTRINSIC
coiled coil region	1039	1072	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000185356
AA Change: R67Q

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000140514
Gene: ENSMUSG00000026479
AA Change: R67Q

Domain	Start	End	E-Value	Type
EGF_Lam	28	81	1.03e-7	SMART
EGF_Lam	84	128	2.14e-14	SMART
EGF_Lam	139	184	4.52e-13	SMART
LamB	245	370	7.58e-46	SMART
EGF_like	370	413	3.83e0	SMART
Blast:EGF_like	417	460	8e-23	BLAST
EGF_Lam	462	514	1.95e-8	SMART
EGF_Lam	517	570	1.88e-10	SMART
EGF_like	573	610	2.6e-1	SMART
coiled coil region	612	680	N/A	INTRINSIC
low complexity region	792	817	N/A	INTRINSIC
coiled coil region	952	994	N/A	INTRINSIC
low complexity region	1016	1027	N/A	INTRINSIC
coiled coil region	1039	1072	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188831

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 97.4%
3x: 96.7%
10x: 94.6%
20x: 90.7%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 2. The gamma 2 chain, formerly thought to be a truncated version of beta chain (B2t), is highly homologous to the gamma 1 chain; however, it lacks domain VI, and domains V, IV and III are shorter. It is expressed in several fetal tissues but differently from gamma 1, and is specifically localized to epithelial cells in skin, lung and kidney. The gamma 2 chain together with alpha 3 and beta 3 chains constitute laminin 5 (earlier known as kalinin), which is an integral part of the anchoring filaments that connect epithelial cells to the underlying basement membrane. The epithelium-specific expression of the gamma 2 chain implied its role as an epithelium attachment molecule, and mutations in this gene have been associated with junctional epidermolysis bullosa, a skin disease characterized by blisters due to disruption of the epidermal-dermal junction. Two transcript variants resulting from alternative splicing of the 3' terminal exon, and encoding different isoforms of gamma 2 chain, have been described. The two variants are differentially expressed in embryonic tissues, however, the biological significance of the two forms is not known. Transcript variants utilizing alternative polyA_signal have also been noted in literature. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in cell:cell adhesion involving epithelial cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003H04Rik	T	A	3: 124,556,860	D143V	unknown	Het
Abca8a	A	T	11: 110,071,451	N525K	probably damaging	Het
Abhd12	T	A	2: 150,848,418	D119V	probably damaging	Het
Adamts20	A	T	15: 94,286,344	M1526K	probably benign	Het
AI481877	T	G	4: 59,066,441	I768L	probably benign	Het
Ankdd1a	A	T	9: 65,504,489		probably null	Het
Ankrd1	C	T	19: 36,114,978	C283Y	possibly damaging	Het
Arfgef1	G	C	1: 10,204,890	I312M	probably benign	Het
Bhlhe22	G	A	3: 18,054,975	C63Y	probably damaging	Het
Bmp8a	A	T	4: 123,325,092		probably benign	Het
Ccdc148	A	T	2: 59,001,899	S235T	probably damaging	Het
Ccdc88b	G	A	19: 6,853,532	Q681*	probably null	Het
Cep104	T	A	4: 154,002,546	V842E	probably benign	Het
Chac2	T	C	11: 30,977,568	N117S	probably benign	Het
Cldn8	T	A	16: 88,562,858	I60F	probably benign	Het
Col16a1	G	A	4: 130,077,057		probably null	Het
Col4a1	A	G	8: 11,214,644		probably benign	Het
Cyp2a4	G	T	7: 26,312,210	E285D	probably damaging	Het
Cyp4a31	G	A	4: 115,569,731	G176D	probably benign	Het
Dmxl2	A	C	9: 54,460,949	Y246D	probably damaging	Het
Dync1h1	A	G	12: 110,614,059	K118R	probably damaging	Het
Eif3h	T	C	15: 51,865,436	T8A	possibly damaging	Het
Fam71d	G	A	12: 78,715,506		probably benign	Het
Fbxo18	G	T	2: 11,767,400	L157I	probably benign	Het
Fbxo40	C	A	16: 36,968,856	G631*	probably null	Het
Gabrb1	T	A	5: 72,121,938		probably null	Het
Galc	A	G	12: 98,234,240		probably null	Het
Gm10436	T	C	12: 88,178,448	E44G	possibly damaging	Het
H2-Q7	C	A	17: 35,439,699	S104R	probably benign	Het
Igkv13-54-1	A	T	6: 69,617,293	M31L	probably benign	Het
Lcn10	A	G	2: 25,685,139	D173G	probably damaging	Het
Llgl2	G	T	11: 115,851,100	R656L	probably damaging	Het
Lonrf2	G	A	1: 38,813,276	P165S	probably benign	Het
Lrrc66	G	A	5: 73,607,426	S758L	possibly damaging	Het
Ly6d	T	C	15: 74,762,766	K46E	probably damaging	Het
Map3k5	A	G	10: 20,099,560	N88D	probably damaging	Het
Mertk	A	T	2: 128,762,212	E422V	probably benign	Het
Mixl1	A	G	1: 180,694,731	V195A	probably benign	Het
Nmnat3	T	C	9: 98,399,468	V41A	probably damaging	Het
Olfr13	A	G	6: 43,174,900	R305G	probably benign	Het
Olfr398	A	T	11: 73,984,493	N38K	probably damaging	Het
Olfr854	A	G	9: 19,567,196	Y63H	possibly damaging	Het
Pappa2	T	A	1: 158,857,316	E751V	probably damaging	Het
Pcsk2	A	G	2: 143,793,269	S355G	probably damaging	Het
Pdzd2	A	G	15: 12,390,048	V821A	probably damaging	Het
Pifo	C	T	3: 106,014,596	E4K	possibly damaging	Het
Plxna4	A	C	6: 32,197,826	D1109E	probably benign	Het
Ppard	A	G	17: 28,297,110	M103V	probably benign	Het
Ralgapa1	T	C	12: 55,757,967	T515A	probably benign	Het
Rin2	A	G	2: 145,861,171	I596V	possibly damaging	Het
Rnls	A	G	19: 33,168,495	S75P	possibly damaging	Het
Rsph10b	A	T	5: 143,967,179	Y236F	possibly damaging	Het
Runx1t1	C	T	4: 13,835,628		probably benign	Het
Sardh	A	G	2: 27,235,569	V311A	possibly damaging	Het
Sbno2	G	T	10: 80,060,605	Y889*	probably null	Het
Sclt1	A	G	3: 41,727,111	V91A	probably damaging	Het
Sema4g	T	A	19: 44,999,017	V534E	probably benign	Het
Slc10a1	G	A	12: 80,953,672	S351F	probably benign	Het
Slc19a3	A	T	1: 83,022,747	V183E	probably damaging	Het
Slc25a12	A	G	2: 71,333,710	Y74H	possibly damaging	Het
Slc6a19	T	A	13: 73,692,950	I114L	probably benign	Het
Smpd2	A	T	10: 41,488,236	C189S	probably benign	Het
Spon1	T	A	7: 114,016,785	V295D	probably benign	Het
Tet3	A	G	6: 83,403,645	S514P	probably benign	Het
Tnk1	T	C	11: 69,856,928	I49M	probably damaging	Het
Trim80	A	G	11: 115,446,793	T431A	probably benign	Het
Vgf	A	T	5: 137,031,299	Q105L	possibly damaging	Het
Vmn1r37	G	T	6: 66,731,796	L135F	probably benign	Het
Vps37d	C	T	5: 135,073,740	A128T	possibly damaging	Het
Wdr60	T	A	12: 116,207,743	S958C	probably damaging	Het
Wwp1	T	C	4: 19,650,197	D323G	probably benign	Het
Zfp456	T	A	13: 67,367,363	I75L	probably benign	Het
Zfp990	A	G	4: 145,538,210	I593V	possibly damaging	Het

Other mutations in Lamc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00771:Lamc2	APN	1	153130056	missense	probably benign	0.00
IGL00907:Lamc2	APN	1	153144651	missense	probably benign	0.32
IGL02026:Lamc2	APN	1	153144736	splice site	probably benign
IGL02335:Lamc2	APN	1	153166216	missense	probably benign	0.00
IGL02568:Lamc2	APN	1	153166262	missense	possibly damaging	0.91
IGL02640:Lamc2	APN	1	153152057	missense	probably damaging	0.99
IGL02801:Lamc2	APN	1	153136783	missense	probably benign	0.10
IGL02827:Lamc2	APN	1	153139781	missense	probably damaging	1.00
IGL03240:Lamc2	APN	1	153124125	missense	probably damaging	1.00
IGL03245:Lamc2	APN	1	153133757	splice site	probably null
abasement	UTSW	1	153127025	missense	probably null	0.86
ANU74:Lamc2	UTSW	1	153131835	missense	probably benign	0.00
R0279:Lamc2	UTSW	1	153130696	missense	probably benign	0.01
R0528:Lamc2	UTSW	1	153124094	missense	probably damaging	1.00
R0597:Lamc2	UTSW	1	153133621	missense	probably benign	0.02
R0650:Lamc2	UTSW	1	153143876	missense	possibly damaging	0.88
R0826:Lamc2	UTSW	1	153152082	missense	probably damaging	1.00
R1015:Lamc2	UTSW	1	153166199	missense	possibly damaging	0.53
R1172:Lamc2	UTSW	1	153166287	missense	probably damaging	1.00
R1308:Lamc2	UTSW	1	153150818	missense	probably damaging	1.00
R1521:Lamc2	UTSW	1	153166263	missense	probably benign	0.11
R1525:Lamc2	UTSW	1	153130756	missense	probably benign	0.00
R1602:Lamc2	UTSW	1	153127028	missense	probably benign	0.00
R1631:Lamc2	UTSW	1	153158934	missense	possibly damaging	0.95
R1633:Lamc2	UTSW	1	153141698	nonsense	probably null
R1978:Lamc2	UTSW	1	153133597	critical splice donor site	probably null
R1996:Lamc2	UTSW	1	153154470	missense	possibly damaging	0.84
R2046:Lamc2	UTSW	1	153141765	missense	probably benign	0.01
R2107:Lamc2	UTSW	1	153154386	splice site	probably benign
R2130:Lamc2	UTSW	1	153127124	missense	probably damaging	1.00
R2182:Lamc2	UTSW	1	153126866	missense	possibly damaging	0.46
R2207:Lamc2	UTSW	1	153133706	missense	possibly damaging	0.68
R2218:Lamc2	UTSW	1	153130779	missense	probably benign	0.21
R3772:Lamc2	UTSW	1	153124251	missense	probably benign
R4616:Lamc2	UTSW	1	153166169	missense	probably damaging	1.00
R4874:Lamc2	UTSW	1	153154395	missense	probably null	1.00
R4939:Lamc2	UTSW	1	153126836	missense	probably damaging	1.00
R4985:Lamc2	UTSW	1	153136805	missense	probably benign
R5544:Lamc2	UTSW	1	153124053	missense	possibly damaging	0.93
R5632:Lamc2	UTSW	1	153131890	missense	probably damaging	1.00
R5771:Lamc2	UTSW	1	153141594	missense	probably benign	0.04
R5811:Lamc2	UTSW	1	153166253	missense	possibly damaging	0.53
R6058:Lamc2	UTSW	1	153136829	missense	probably benign	0.01
R6130:Lamc2	UTSW	1	153136777	missense	probably benign	0.01
R6137:Lamc2	UTSW	1	153166153	missense	possibly damaging	0.90
R6994:Lamc2	UTSW	1	153136762	missense	probably benign	0.18
R6995:Lamc2	UTSW	1	153136762	missense	probably benign	0.18
R6997:Lamc2	UTSW	1	153136762	missense	probably benign	0.18
R7000:Lamc2	UTSW	1	153166127	missense	possibly damaging	0.72
R7018:Lamc2	UTSW	1	153136742	missense	probably benign	0.00
R7145:Lamc2	UTSW	1	153130772	missense	possibly damaging	0.95
R7148:Lamc2	UTSW	1	153185984	missense	probably benign	0.01
R7171:Lamc2	UTSW	1	153139749	missense	probably damaging	1.00
R7640:Lamc2	UTSW	1	153136804	missense	possibly damaging	0.79
R7673:Lamc2	UTSW	1	153124036	missense	probably damaging	1.00
R7684:Lamc2	UTSW	1	153127025	missense	probably null	0.86
R7712:Lamc2	UTSW	1	153133611	missense	possibly damaging	0.81
R7940:Lamc2	UTSW	1	153130775	nonsense	probably null
R8153:Lamc2	UTSW	1	153124104	frame shift	probably null
R8211:Lamc2	UTSW	1	153166278	missense	probably damaging	1.00
R8486:Lamc2	UTSW	1	153158891	missense	probably benign
R8739:Lamc2	UTSW	1	153144653	nonsense	probably null
R8744:Lamc2	UTSW	1	153143738	missense	probably benign	0.19
R8911:Lamc2	UTSW	1	153152127	missense	probably damaging	1.00
R9435:Lamc2	UTSW	1	153137326	missense	probably benign	0.00
R9457:Lamc2	UTSW	1	153139854	missense	probably benign
RF024:Lamc2	UTSW	1	153152055	missense	possibly damaging	0.70
Z1176:Lamc2	UTSW	1	153133621	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- ACCCAGTTGTGCAACATCTCTC -3'
(R):5'- TAGTTTAAGTCATGTTAGCCCATGC -3'

Sequencing Primer
(F):5'- AGTTGTGCAACATCTCTCTAGTC -3'
(R):5'- GTCATGTTAGCCCATGCATAACAG -3'

Posted On

2014-06-23