Mutagenetix > Incidental Mutation

Incidental Mutation 'R1854:Wdfy3'

205906

Institutional Source

Beutler Lab

Gene Symbol

Wdfy3

Ensembl Gene

ENSMUSG00000043940

Gene Name

WD repeat and FYVE domain containing 3

Synonyms

D5Ertd66e, Bwf1, Bchs, 2610509D04Rik, Ggtb3

MMRRC Submission

039878-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.938) question?

Stock #

R1854 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101832956-102069921 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 101888186 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 2122 (V2122E)

Ref Sequence

ENSEMBL: ENSMUSP00000134244 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053177] [ENSMUST00000174598] [ENSMUST00000212024]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000053177
AA Change: V2122E

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000052607
Gene: ENSMUSG00000043940
AA Change: V2122E

Domain	Start	End	E-Value	Type
low complexity region	463	481	N/A	INTRINSIC
low complexity region	1408	1417	N/A	INTRINSIC
low complexity region	1629	1644	N/A	INTRINSIC
Pfam:PH_BEACH	2517	2638	3.1e-17	PFAM
Beach	2677	2958	2.54e-217	SMART
WD40	3054	3088	1.28e1	SMART
WD40	3098	3137	7.73e-6	SMART
WD40	3140	3178	8.29e-1	SMART
WD40	3183	3227	3.09e-1	SMART
low complexity region	3253	3274	N/A	INTRINSIC
low complexity region	3307	3318	N/A	INTRINSIC
WD40	3381	3420	1.33e1	SMART
FYVE	3428	3497	3.18e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000174598
AA Change: V2122E

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000134244
Gene: ENSMUSG00000043940
AA Change: V2122E

Domain	Start	End	E-Value	Type
low complexity region	463	481	N/A	INTRINSIC
Pfam:DUF4704	1392	1597	6.6e-11	PFAM
low complexity region	1629	1644	N/A	INTRINSIC
Pfam:PH_BEACH	2588	2656	1.8e-14	PFAM
Beach	2695	2976	2.54e-217	SMART
WD40	3072	3106	1.28e1	SMART
WD40	3116	3155	7.73e-6	SMART
WD40	3158	3196	8.29e-1	SMART
WD40	3201	3245	3.09e-1	SMART
low complexity region	3271	3292	N/A	INTRINSIC
low complexity region	3325	3336	N/A	INTRINSIC
WD40	3399	3438	1.33e1	SMART
FYVE	3446	3515	3.18e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000212024
AA Change: V2107E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol 3-phosphate-binding protein that functions as a master conductor for aggregate clearance by autophagy. This protein shuttles from the nuclear membrane to colocalize with aggregated proteins, where it complexes with other autophagic components to achieve macroautophagy-mediated clearance of these aggregated proteins. However, it is not necessary for starvation-induced macroautophagy. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for hypomorphic mutations of this gene exhibit perinatal lethality, altered neural progenitor divisions and neuronal migration, a regionally enlarged cerebral cortex, and focal cortical dysplasias. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 113 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061N02Rik	C	T	16: 88,707,780	R43K	possibly damaging	Het
Acp1	A	G	12: 30,897,805	I78T	possibly damaging	Het
Afap1l1	G	T	18: 61,743,294	D417E	probably benign	Het
Agap2	G	A	10: 127,080,516	V299I	unknown	Het
Ahnak	C	T	19: 9,013,832	A4160V	possibly damaging	Het
Anapc1	T	C	2: 128,675,890	E278G	probably damaging	Het
Atad2	G	A	15: 58,097,289	P971L	possibly damaging	Het
Atg2a	A	G	19: 6,252,431	E928G	probably benign	Het
Atp2b2	A	C	6: 113,842,283	N16K	probably damaging	Het
Atp6ap1l	T	C	13: 90,883,588	E325G	probably damaging	Het
Bfsp2	C	T	9: 103,449,831	G236S	probably benign	Het
Ccar1	A	T	10: 62,764,517	I545N	probably damaging	Het
Ccser2	A	G	14: 36,918,591	C11R	possibly damaging	Het
Cdc42bpg	A	T	19: 6,320,807	H1310L	possibly damaging	Het
Ces1h	T	C	8: 93,358,822	K339E	probably benign	Het
Cit	A	G	5: 115,873,901	Y189C	probably damaging	Het
Cnih3	C	A	1: 181,454,621	S140*	probably null	Het
Cntrl	A	G	2: 35,122,684	D278G	probably damaging	Het
Col24a1	G	A	3: 145,459,140	G1033D	probably damaging	Het
Col6a1	T	G	10: 76,721,949	Y151S	probably damaging	Het
Col6a2	T	A	10: 76,614,812	Q95L	probably damaging	Het
Cpd	G	T	11: 76,786,338	P1185Q	probably damaging	Het
Cycs	T	A	6: 50,565,329	I76F	possibly damaging	Het
Cyp4f16	T	A	17: 32,537,099	I34N	probably damaging	Het
Ddx1	A	C	12: 13,229,331	S436A	probably benign	Het
Defa30	A	G	8: 21,135,484	Y88C	probably damaging	Het
Dhx30	G	A	9: 110,088,672	L317F	probably damaging	Het
Dll3	C	A	7: 28,296,410	G322V	probably damaging	Het
Dnah10	G	A	5: 124,804,689	D2843N	probably damaging	Het
Dnaja3	C	T	16: 4,697,269	T266I	probably damaging	Het
Dpp9	T	C	17: 56,202,885	I314V	probably benign	Het
E030025P04Rik	A	G	11: 109,143,918	V48A	unknown	Het
Enpp2	C	T	15: 54,845,823	E803K	probably damaging	Het
Eri3	G	A	4: 117,649,365	G297D	probably benign	Het
Esp34	A	G	17: 38,559,533	E38G	possibly damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam122b	T	A	X: 53,254,056	Q201H	probably benign	Het
Frzb	A	G	2: 80,446,380	V154A	possibly damaging	Het
Fsip2	G	T	2: 82,993,257	A6445S	possibly damaging	Het
Gm11938	G	A	11: 99,603,017	T84I	possibly damaging	Het
Gm4787	T	A	12: 81,378,334	H350L	probably damaging	Het
Gpa33	A	G	1: 166,165,190	I291V	probably benign	Het
Gpr158	A	G	2: 21,369,124	Y290C	probably damaging	Het
Gpsm1	G	T	2: 26,344,713	G84W	probably damaging	Het
Hormad1	A	G	3: 95,580,006	N267S	probably benign	Het
Htr2a	A	T	14: 74,705,753	I258F	probably damaging	Het
Htra4	T	C	8: 25,033,581	T323A	probably damaging	Het
Ift140	T	A	17: 25,035,839	F162Y	probably benign	Het
Islr2	T	C	9: 58,199,816	T54A	probably damaging	Het
Kcna4	T	G	2: 107,296,484	V521G	probably damaging	Het
Kdr	C	T	5: 75,952,905	G768S	possibly damaging	Het
Kif6	G	T	17: 49,901,771	A740S	probably benign	Het
Lad1	T	A	1: 135,827,730	V248E	probably damaging	Het
Lamb1	T	G	12: 31,318,272	C1134G	probably damaging	Het
Lamc1	A	G	1: 153,249,872	Y552H	probably damaging	Het
Maats1	T	C	16: 38,324,297		probably null	Het
Mctp1	A	T	13: 76,825,741	T706S	probably damaging	Het
Med12l	A	G	3: 59,260,772	Y1541C	probably damaging	Het
Mnx1	C	T	5: 29,477,782	S165N	unknown	Het
Morn3	A	T	5: 123,046,629		probably null	Het
Nalcn	C	T	14: 123,460,412	R484Q	probably damaging	Het
Nr4a1	T	C	15: 101,271,764	I305T	probably benign	Het
Olfr30	G	A	11: 58,455,431	R173W	probably damaging	Het
Olfr339	C	T	2: 36,421,874	H159Y	probably damaging	Het
Pcdhb5	T	C	18: 37,322,340	V591A	possibly damaging	Het
Pdia3	T	C	2: 121,431,663	I205T	probably benign	Het
Pdia4	A	T	6: 47,813,227	D26E	unknown	Het
Phactr3	C	A	2: 178,283,147	L292M	probably damaging	Het
Phf21b	T	A	15: 84,854,762	I21F	probably benign	Het
Pign	A	G	1: 105,554,498	V791A	probably damaging	Het
Pitpna	A	G	11: 75,609,103		probably null	Het
Piwil1	G	T	5: 128,747,839	E534*	probably null	Het
Plcz1	T	A	6: 139,993,049	I526F	probably benign	Het
Pms2	A	T	5: 143,925,896	K607I	probably benign	Het
Pnn	T	A	12: 59,071,613	N327K	probably damaging	Het
Pogz	C	T	3: 94,878,849	T863I	probably benign	Het
Polq	C	T	16: 37,062,109	T1545I	probably benign	Het
Psd4	G	A	2: 24,397,456	E467K	probably benign	Het
Pstpip2	T	A	18: 77,871,799	L198Q	probably damaging	Het
Pzp	T	C	6: 128,502,225	Y655C	probably damaging	Het
Qrsl1	C	T	10: 43,894,545	G117E	probably damaging	Het
Rad54b	G	A	4: 11,601,669	C408Y	probably damaging	Het
Ralb	T	A	1: 119,476,067	Q110L	possibly damaging	Het
Rrm2	A	G	12: 24,713,152	K218E	probably damaging	Het
Siglece	A	G	7: 43,659,936	F66S	probably benign	Het
Slc17a8	A	T	10: 89,606,765	C69S	unknown	Het
Slc1a6	T	A	10: 78,812,924	V493E	probably damaging	Het
Slc38a11	A	T	2: 65,363,516		probably null	Het
Smarcal1	G	A	1: 72,586,099	G135D	possibly damaging	Het
Snrnp70	T	A	7: 45,377,220	R242*	probably null	Het
St3gal5	T	C	6: 72,132,093	L55P	probably damaging	Het
Sulf1	A	G	1: 12,838,437	N558S	probably benign	Het
Supt6	T	C	11: 78,232,540	I104V	possibly damaging	Het
Tas2r113	T	A	6: 132,893,329	Y107N	probably damaging	Het
Tcf7	A	G	11: 52,257,064	V187A	probably benign	Het
Tdrd9	G	A	12: 112,044,812	G1152R	probably damaging	Het
Tfpi	A	G	2: 84,458,107	Y9H	probably benign	Het
Tnk2	G	A	16: 32,680,142	V758I	probably damaging	Het
Trim72	A	G	7: 128,009,082	I251V	probably benign	Het
Trip12	T	A	1: 84,728,145	N655Y	probably damaging	Het
Ttn	A	G	2: 76,751,429	V23040A	probably damaging	Het
Tulp2	T	A	7: 45,517,943	N188K	probably damaging	Het
Ube2c	C	T	2: 164,771,362	H67Y	probably damaging	Het
Unc80	C	A	1: 66,631,414	P1899T	possibly damaging	Het
Usp34	C	T	11: 23,426,153	A1879V	probably benign	Het
Vmn2r118	G	A	17: 55,611,556	S112L	possibly damaging	Het
Zcchc4	A	G	5: 52,815,826	Y344C	probably damaging	Het
Zdbf2	GAAAAA	GAAAAAA	1: 63,305,542		probably null	Het
Zdhhc25	A	T	15: 88,600,486	H8L	probably benign	Het
Zfp455	A	T	13: 67,207,817	H383L	probably damaging	Het
Zfp663	A	G	2: 165,353,291	I336T	probably benign	Het
Zfp738	T	A	13: 67,670,357	H505L	probably damaging	Het
Zfp84	T	G	7: 29,775,371	F23V	possibly damaging	Het

Other mutations in Wdfy3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Wdfy3	APN	5	101915338	critical splice donor site	probably null
IGL00567:Wdfy3	APN	5	101912030	splice site	probably benign
IGL01288:Wdfy3	APN	5	101901991	splice site	probably null
IGL01323:Wdfy3	APN	5	101895064	missense	probably damaging	1.00
IGL01352:Wdfy3	APN	5	101944120	missense	probably damaging	1.00
IGL01553:Wdfy3	APN	5	101900031	missense	probably benign
IGL01560:Wdfy3	APN	5	101957486	nonsense	probably null
IGL01566:Wdfy3	APN	5	101896588	splice site	probably benign
IGL01616:Wdfy3	APN	5	101913260	missense	probably damaging	0.97
IGL01630:Wdfy3	APN	5	101907488	missense	probably benign
IGL01791:Wdfy3	APN	5	101937412	missense	probably damaging	1.00
IGL01820:Wdfy3	APN	5	101924081	missense	probably benign	0.11
IGL01953:Wdfy3	APN	5	101895028	nonsense	probably null
IGL02121:Wdfy3	APN	5	101898510	missense	possibly damaging	0.85
IGL02167:Wdfy3	APN	5	101961157	missense	probably damaging	0.98
IGL02321:Wdfy3	APN	5	101922609	missense	probably damaging	0.99
IGL02327:Wdfy3	APN	5	101888192	missense	probably damaging	1.00
IGL02651:Wdfy3	APN	5	101896475	missense	probably benign	0.37
IGL02801:Wdfy3	APN	5	101907587	missense	probably damaging	1.00
IGL02839:Wdfy3	APN	5	101968920	missense	probably damaging	1.00
IGL02870:Wdfy3	APN	5	101855471	missense	probably damaging	1.00
IGL02997:Wdfy3	APN	5	101894912	missense	probably null	1.00
IGL03064:Wdfy3	APN	5	101935997	missense	probably damaging	0.99
IGL03090:Wdfy3	APN	5	101866276	missense	probably damaging	1.00
IGL03211:Wdfy3	APN	5	101844912	splice site	probably benign
IGL03237:Wdfy3	APN	5	101844599	missense	probably damaging	1.00
IGL03264:Wdfy3	APN	5	101900150	missense	probably damaging	1.00
Esurient	UTSW	5	101944103	missense	probably damaging	1.00
IGL02988:Wdfy3	UTSW	5	101929981	missense	probably damaging	0.99
PIT4382001:Wdfy3	UTSW	5	101882961	frame shift	probably null
R0010:Wdfy3	UTSW	5	101848349	missense	probably damaging	1.00
R0010:Wdfy3	UTSW	5	101848349	missense	probably damaging	1.00
R0025:Wdfy3	UTSW	5	101845046	missense	probably damaging	0.98
R0031:Wdfy3	UTSW	5	101889295	missense	probably damaging	0.97
R0047:Wdfy3	UTSW	5	101944033	missense	probably damaging	1.00
R0047:Wdfy3	UTSW	5	101944033	missense	probably damaging	1.00
R0053:Wdfy3	UTSW	5	101844614	missense	probably damaging	0.97
R0078:Wdfy3	UTSW	5	101888105	missense	possibly damaging	0.57
R0147:Wdfy3	UTSW	5	101917411	missense	probably benign	0.05
R0148:Wdfy3	UTSW	5	101917411	missense	probably benign	0.05
R0279:Wdfy3	UTSW	5	101868092	missense	probably damaging	1.00
R0380:Wdfy3	UTSW	5	101948966	missense	probably damaging	0.99
R0472:Wdfy3	UTSW	5	101957443	missense	probably benign	0.13
R0513:Wdfy3	UTSW	5	101890789	missense	probably damaging	0.96
R0594:Wdfy3	UTSW	5	101906185	missense	possibly damaging	0.94
R0601:Wdfy3	UTSW	5	101836172	missense	probably benign
R0787:Wdfy3	UTSW	5	101957388	missense	probably damaging	1.00
R0825:Wdfy3	UTSW	5	101870051	missense	probably damaging	1.00
R1122:Wdfy3	UTSW	5	101882966	missense	possibly damaging	0.94
R1167:Wdfy3	UTSW	5	101875931	missense	probably benign
R1350:Wdfy3	UTSW	5	101898552	missense	probably damaging	1.00
R1422:Wdfy3	UTSW	5	101884214	splice site	probably benign
R1446:Wdfy3	UTSW	5	101851310	missense	possibly damaging	0.68
R1452:Wdfy3	UTSW	5	101937738	missense	possibly damaging	0.91
R1457:Wdfy3	UTSW	5	101917579	missense	possibly damaging	0.57
R1543:Wdfy3	UTSW	5	101844081	missense	probably benign
R1633:Wdfy3	UTSW	5	101981548	missense	probably damaging	1.00
R1643:Wdfy3	UTSW	5	101875915	missense	possibly damaging	0.62
R1656:Wdfy3	UTSW	5	101941447	missense	probably damaging	1.00
R1720:Wdfy3	UTSW	5	101926525	frame shift	probably null
R1743:Wdfy3	UTSW	5	101844065	missense	probably benign	0.12
R1745:Wdfy3	UTSW	5	101948929	missense	probably damaging	0.96
R1850:Wdfy3	UTSW	5	101894999	missense	probably damaging	1.00
R1852:Wdfy3	UTSW	5	101915376	missense	probably benign	0.00
R1880:Wdfy3	UTSW	5	101917435	missense	probably benign	0.05
R1930:Wdfy3	UTSW	5	101941492	missense	probably damaging	1.00
R1931:Wdfy3	UTSW	5	101941492	missense	probably damaging	1.00
R1956:Wdfy3	UTSW	5	101919409	missense	probably benign	0.30
R1965:Wdfy3	UTSW	5	101951312	missense	probably damaging	1.00
R1997:Wdfy3	UTSW	5	101968946	missense	probably damaging	1.00
R2015:Wdfy3	UTSW	5	101860486	missense	probably null	1.00
R2087:Wdfy3	UTSW	5	101895060	missense	probably damaging	1.00
R2156:Wdfy3	UTSW	5	101898425	critical splice donor site	probably null
R2192:Wdfy3	UTSW	5	101907542	missense	possibly damaging	0.55
R2313:Wdfy3	UTSW	5	101889284	missense	probably damaging	1.00
R2332:Wdfy3	UTSW	5	101888323	splice site	probably benign
R2406:Wdfy3	UTSW	5	101888259	missense	probably damaging	1.00
R2679:Wdfy3	UTSW	5	101870036	missense	probably damaging	1.00
R2857:Wdfy3	UTSW	5	101875930	missense	probably benign	0.04
R2937:Wdfy3	UTSW	5	101944122	missense	probably benign	0.07
R3765:Wdfy3	UTSW	5	101861400	missense	probably damaging	1.00
R3795:Wdfy3	UTSW	5	101937600	missense	probably damaging	1.00
R3937:Wdfy3	UTSW	5	101944239	nonsense	probably null
R3947:Wdfy3	UTSW	5	101870036	missense	probably damaging	1.00
R4024:Wdfy3	UTSW	5	101924095	splice site	probably benign
R4065:Wdfy3	UTSW	5	101922447	missense	probably benign	0.08
R4066:Wdfy3	UTSW	5	101922447	missense	probably benign	0.08
R4110:Wdfy3	UTSW	5	101900058	critical splice donor site	probably null
R4235:Wdfy3	UTSW	5	101922634	critical splice acceptor site	probably null
R4420:Wdfy3	UTSW	5	101910984	missense	probably damaging	0.97
R4620:Wdfy3	UTSW	5	101906145	missense	probably damaging	0.99
R4624:Wdfy3	UTSW	5	101884083	missense	possibly damaging	0.52
R4626:Wdfy3	UTSW	5	101943934	missense	probably damaging	1.00
R4727:Wdfy3	UTSW	5	101930028	missense	probably damaging	0.99
R4794:Wdfy3	UTSW	5	101943943	missense	probably damaging	1.00
R4869:Wdfy3	UTSW	5	101894921	missense	probably damaging	0.98
R4971:Wdfy3	UTSW	5	101948972	nonsense	probably null
R4973:Wdfy3	UTSW	5	101943119	missense	probably benign	0.00
R4976:Wdfy3	UTSW	5	101943119	missense	probably benign	0.00
R4984:Wdfy3	UTSW	5	101943119	missense	probably benign	0.00
R4986:Wdfy3	UTSW	5	101943119	missense	probably benign	0.00
R5068:Wdfy3	UTSW	5	101894937	missense	probably benign	0.15
R5105:Wdfy3	UTSW	5	101855549	missense	probably damaging	1.00
R5120:Wdfy3	UTSW	5	101868106	missense	possibly damaging	0.85
R5134:Wdfy3	UTSW	5	101944103	missense	probably damaging	1.00
R5139:Wdfy3	UTSW	5	101849267	critical splice donor site	probably null
R5235:Wdfy3	UTSW	5	101847106	missense	probably null	0.03
R5303:Wdfy3	UTSW	5	101952983	missense	probably damaging	1.00
R5368:Wdfy3	UTSW	5	101872858	missense	probably damaging	1.00
R5426:Wdfy3	UTSW	5	101919446	missense	probably damaging	0.97
R5442:Wdfy3	UTSW	5	101896559	missense	probably benign	0.04
R5487:Wdfy3	UTSW	5	101836274	missense	probably damaging	1.00
R5509:Wdfy3	UTSW	5	101861448	missense	possibly damaging	0.69
R5877:Wdfy3	UTSW	5	101869989	missense	probably damaging	1.00
R5988:Wdfy3	UTSW	5	101884138	missense	probably benign	0.00
R6017:Wdfy3	UTSW	5	101851359	missense	probably benign	0.01
R6019:Wdfy3	UTSW	5	101849423	missense	probably damaging	1.00
R6199:Wdfy3	UTSW	5	101872965	missense	possibly damaging	0.93
R6228:Wdfy3	UTSW	5	101898429	missense	possibly damaging	0.67
R6258:Wdfy3	UTSW	5	101872965	missense	possibly damaging	0.93
R6259:Wdfy3	UTSW	5	101872965	missense	possibly damaging	0.93
R6298:Wdfy3	UTSW	5	101968946	missense	probably damaging	1.00
R6479:Wdfy3	UTSW	5	101913179	missense	probably damaging	1.00
R6550:Wdfy3	UTSW	5	101953166	missense	probably benign	0.19
R6776:Wdfy3	UTSW	5	101884045	missense	possibly damaging	0.57
R6793:Wdfy3	UTSW	5	101917431	nonsense	probably null
R6809:Wdfy3	UTSW	5	101923947	missense	possibly damaging	0.63
R6836:Wdfy3	UTSW	5	101952999	missense	probably damaging	1.00
R6897:Wdfy3	UTSW	5	101844066	missense	probably benign	0.10
R7014:Wdfy3	UTSW	5	101894909	critical splice donor site	probably null
R7034:Wdfy3	UTSW	5	101907518	missense	probably damaging	1.00
R7035:Wdfy3	UTSW	5	101855549	missense	probably damaging	1.00
R7135:Wdfy3	UTSW	5	101915437	missense	probably damaging	1.00
R7182:Wdfy3	UTSW	5	101943892	missense	possibly damaging	0.51
R7217:Wdfy3	UTSW	5	101901919	missense	probably damaging	1.00
R7236:Wdfy3	UTSW	5	101836208	missense	probably damaging	0.99
R7264:Wdfy3	UTSW	5	101855523	missense	probably benign	0.02
R7418:Wdfy3	UTSW	5	101957500	missense	probably benign	0.08
R7533:Wdfy3	UTSW	5	101882488	missense	probably benign	0.27
R7543:Wdfy3	UTSW	5	101936059	missense	probably benign	0.00
R7625:Wdfy3	UTSW	5	101855386	splice site	probably null
R7788:Wdfy3	UTSW	5	101848357	missense	probably damaging	0.99
R7810:Wdfy3	UTSW	5	101895074	missense	probably benign	0.01
R7810:Wdfy3	UTSW	5	101951399	nonsense	probably null
R8204:Wdfy3	UTSW	5	101852585	missense	probably benign	0.00
R8268:Wdfy3	UTSW	5	101941610	missense	probably damaging	1.00
R8286:Wdfy3	UTSW	5	101937421	missense	probably benign
R8507:Wdfy3	UTSW	5	101872901	missense	probably benign	0.05
R8514:Wdfy3	UTSW	5	101851353	missense	possibly damaging	0.92
R8536:Wdfy3	UTSW	5	101885198	missense	probably benign
R8710:Wdfy3	UTSW	5	101882483	missense	probably damaging	1.00
R8735:Wdfy3	UTSW	5	101930085	missense	probably benign	0.00
R8749:Wdfy3	UTSW	5	101882580	missense	probably damaging	1.00
R8931:Wdfy3	UTSW	5	101917555	missense	probably benign	0.11
R8943:Wdfy3	UTSW	5	101845365	intron	probably benign
R8968:Wdfy3	UTSW	5	101864117	missense	probably benign	0.05
R8979:Wdfy3	UTSW	5	101948898	missense	probably damaging	1.00
R8998:Wdfy3	UTSW	5	101845192	missense	probably benign	0.05
R9045:Wdfy3	UTSW	5	101847174	missense	probably damaging	1.00
R9068:Wdfy3	UTSW	5	101852585	missense	probably benign	0.34
R9105:Wdfy3	UTSW	5	101882646	missense	probably benign	0.05
R9122:Wdfy3	UTSW	5	101943965	missense	probably damaging	1.00
R9209:Wdfy3	UTSW	5	101930964	missense	probably benign	0.01
R9249:Wdfy3	UTSW	5	101848493	missense	possibly damaging	0.82
R9348:Wdfy3	UTSW	5	101941492	missense	probably damaging	1.00
R9481:Wdfy3	UTSW	5	101852612	missense	probably benign	0.19
R9490:Wdfy3	UTSW	5	101930850	missense	probably benign	0.29
R9524:Wdfy3	UTSW	5	101907467	missense	probably benign	0.03
R9545:Wdfy3	UTSW	5	101953091	missense
R9548:Wdfy3	UTSW	5	101885193	missense	probably damaging	0.99
R9636:Wdfy3	UTSW	5	101900033	missense	probably benign
R9750:Wdfy3	UTSW	5	101930094	missense	probably benign	0.00
R9766:Wdfy3	UTSW	5	101895000	missense	possibly damaging	0.90
R9771:Wdfy3	UTSW	5	101852329	missense	probably damaging	1.00
Z1177:Wdfy3	UTSW	5	101900241	missense	probably benign	0.39

Predicted Primers

PCR Primer
(F):5'- GCCCTGTACAGCTTTCATAAAGTG -3'
(R):5'- AACGACAGTGGGGATTTGC -3'

Sequencing Primer
(F):5'- TGTACAGCTTTCATAAAGTGGTAAAC -3'
(R):5'- AACGACAGTGGGGATTTGCATTTC -3'

Posted On

2014-06-23