Incidental Mutation 'R1854:Wdfy3'
ID205906
Institutional Source Beutler Lab
Gene Symbol Wdfy3
Ensembl Gene ENSMUSG00000043940
Gene NameWD repeat and FYVE domain containing 3
SynonymsD5Ertd66e, Bwf1, Bchs, 2610509D04Rik, Ggtb3
MMRRC Submission 039878-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.916) question?
Stock #R1854 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location101832956-102069921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101888186 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 2122 (V2122E)
Ref Sequence ENSEMBL: ENSMUSP00000134244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053177] [ENSMUST00000174598] [ENSMUST00000212024]
Predicted Effect probably benign
Transcript: ENSMUST00000053177
AA Change: V2122E

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000052607
Gene: ENSMUSG00000043940
AA Change: V2122E

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
low complexity region 1408 1417 N/A INTRINSIC
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2517 2638 3.1e-17 PFAM
Beach 2677 2958 2.54e-217 SMART
WD40 3054 3088 1.28e1 SMART
WD40 3098 3137 7.73e-6 SMART
WD40 3140 3178 8.29e-1 SMART
WD40 3183 3227 3.09e-1 SMART
low complexity region 3253 3274 N/A INTRINSIC
low complexity region 3307 3318 N/A INTRINSIC
WD40 3381 3420 1.33e1 SMART
FYVE 3428 3497 3.18e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174598
AA Change: V2122E

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000134244
Gene: ENSMUSG00000043940
AA Change: V2122E

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
Pfam:DUF4704 1392 1597 6.6e-11 PFAM
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2588 2656 1.8e-14 PFAM
Beach 2695 2976 2.54e-217 SMART
WD40 3072 3106 1.28e1 SMART
WD40 3116 3155 7.73e-6 SMART
WD40 3158 3196 8.29e-1 SMART
WD40 3201 3245 3.09e-1 SMART
low complexity region 3271 3292 N/A INTRINSIC
low complexity region 3325 3336 N/A INTRINSIC
WD40 3399 3438 1.33e1 SMART
FYVE 3446 3515 3.18e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212024
AA Change: V2107E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol 3-phosphate-binding protein that functions as a master conductor for aggregate clearance by autophagy. This protein shuttles from the nuclear membrane to colocalize with aggregated proteins, where it complexes with other autophagic components to achieve macroautophagy-mediated clearance of these aggregated proteins. However, it is not necessary for starvation-induced macroautophagy. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for hypomorphic mutations of this gene exhibit perinatal lethality, altered neural progenitor divisions and neuronal migration, a regionally enlarged cerebral cortex, and focal cortical dysplasias. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik C T 16: 88,707,780 R43K possibly damaging Het
Acp1 A G 12: 30,897,805 I78T possibly damaging Het
Afap1l1 G T 18: 61,743,294 D417E probably benign Het
Agap2 G A 10: 127,080,516 V299I unknown Het
Ahnak C T 19: 9,013,832 A4160V possibly damaging Het
Anapc1 T C 2: 128,675,890 E278G probably damaging Het
Atad2 G A 15: 58,097,289 P971L possibly damaging Het
Atg2a A G 19: 6,252,431 E928G probably benign Het
Atp2b2 A C 6: 113,842,283 N16K probably damaging Het
Atp6ap1l T C 13: 90,883,588 E325G probably damaging Het
Bfsp2 C T 9: 103,449,831 G236S probably benign Het
Ccar1 A T 10: 62,764,517 I545N probably damaging Het
Ccser2 A G 14: 36,918,591 C11R possibly damaging Het
Cdc42bpg A T 19: 6,320,807 H1310L possibly damaging Het
Ces1h T C 8: 93,358,822 K339E probably benign Het
Cit A G 5: 115,873,901 Y189C probably damaging Het
Cnih3 C A 1: 181,454,621 S140* probably null Het
Cntrl A G 2: 35,122,684 D278G probably damaging Het
Col24a1 G A 3: 145,459,140 G1033D probably damaging Het
Col6a1 T G 10: 76,721,949 Y151S probably damaging Het
Col6a2 T A 10: 76,614,812 Q95L probably damaging Het
Cpd G T 11: 76,786,338 P1185Q probably damaging Het
Cycs T A 6: 50,565,329 I76F possibly damaging Het
Cyp4f16 T A 17: 32,537,099 I34N probably damaging Het
Ddx1 A C 12: 13,229,331 S436A probably benign Het
Defa30 A G 8: 21,135,484 Y88C probably damaging Het
Dhx30 G A 9: 110,088,672 L317F probably damaging Het
Dll3 C A 7: 28,296,410 G322V probably damaging Het
Dnah10 G A 5: 124,804,689 D2843N probably damaging Het
Dnaja3 C T 16: 4,697,269 T266I probably damaging Het
Dpp9 T C 17: 56,202,885 I314V probably benign Het
E030025P04Rik A G 11: 109,143,918 V48A unknown Het
Enpp2 C T 15: 54,845,823 E803K probably damaging Het
Eri3 G A 4: 117,649,365 G297D probably benign Het
Esp34 A G 17: 38,559,533 E38G possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam122b T A X: 53,254,056 Q201H probably benign Het
Frzb A G 2: 80,446,380 V154A possibly damaging Het
Fsip2 G T 2: 82,993,257 A6445S possibly damaging Het
Gm11938 G A 11: 99,603,017 T84I possibly damaging Het
Gm4787 T A 12: 81,378,334 H350L probably damaging Het
Gpa33 A G 1: 166,165,190 I291V probably benign Het
Gpr158 A G 2: 21,369,124 Y290C probably damaging Het
Gpsm1 G T 2: 26,344,713 G84W probably damaging Het
Hormad1 A G 3: 95,580,006 N267S probably benign Het
Htr2a A T 14: 74,705,753 I258F probably damaging Het
Htra4 T C 8: 25,033,581 T323A probably damaging Het
Ift140 T A 17: 25,035,839 F162Y probably benign Het
Islr2 T C 9: 58,199,816 T54A probably damaging Het
Kcna4 T G 2: 107,296,484 V521G probably damaging Het
Kdr C T 5: 75,952,905 G768S possibly damaging Het
Kif6 G T 17: 49,901,771 A740S probably benign Het
Lad1 T A 1: 135,827,730 V248E probably damaging Het
Lamb1 T G 12: 31,318,272 C1134G probably damaging Het
Lamc1 A G 1: 153,249,872 Y552H probably damaging Het
Maats1 T C 16: 38,324,297 probably null Het
Mctp1 A T 13: 76,825,741 T706S probably damaging Het
Med12l A G 3: 59,260,772 Y1541C probably damaging Het
Mnx1 C T 5: 29,477,782 S165N unknown Het
Morn3 A T 5: 123,046,629 probably null Het
Nalcn C T 14: 123,460,412 R484Q probably damaging Het
Nr4a1 T C 15: 101,271,764 I305T probably benign Het
Olfr30 G A 11: 58,455,431 R173W probably damaging Het
Olfr339 C T 2: 36,421,874 H159Y probably damaging Het
Pcdhb5 T C 18: 37,322,340 V591A possibly damaging Het
Pdia3 T C 2: 121,431,663 I205T probably benign Het
Pdia4 A T 6: 47,813,227 D26E unknown Het
Phactr3 C A 2: 178,283,147 L292M probably damaging Het
Phf21b T A 15: 84,854,762 I21F probably benign Het
Pign A G 1: 105,554,498 V791A probably damaging Het
Pitpna A G 11: 75,609,103 probably null Het
Piwil1 G T 5: 128,747,839 E534* probably null Het
Plcz1 T A 6: 139,993,049 I526F probably benign Het
Pms2 A T 5: 143,925,896 K607I probably benign Het
Pnn T A 12: 59,071,613 N327K probably damaging Het
Pogz C T 3: 94,878,849 T863I probably benign Het
Polq C T 16: 37,062,109 T1545I probably benign Het
Psd4 G A 2: 24,397,456 E467K probably benign Het
Pstpip2 T A 18: 77,871,799 L198Q probably damaging Het
Pzp T C 6: 128,502,225 Y655C probably damaging Het
Qrsl1 C T 10: 43,894,545 G117E probably damaging Het
Rad54b G A 4: 11,601,669 C408Y probably damaging Het
Ralb T A 1: 119,476,067 Q110L possibly damaging Het
Rrm2 A G 12: 24,713,152 K218E probably damaging Het
Siglece A G 7: 43,659,936 F66S probably benign Het
Slc17a8 A T 10: 89,606,765 C69S unknown Het
Slc1a6 T A 10: 78,812,924 V493E probably damaging Het
Slc38a11 A T 2: 65,363,516 probably null Het
Smarcal1 G A 1: 72,586,099 G135D possibly damaging Het
Snrnp70 T A 7: 45,377,220 R242* probably null Het
St3gal5 T C 6: 72,132,093 L55P probably damaging Het
Sulf1 A G 1: 12,838,437 N558S probably benign Het
Supt6 T C 11: 78,232,540 I104V possibly damaging Het
Tas2r113 T A 6: 132,893,329 Y107N probably damaging Het
Tcf7 A G 11: 52,257,064 V187A probably benign Het
Tdrd9 G A 12: 112,044,812 G1152R probably damaging Het
Tfpi A G 2: 84,458,107 Y9H probably benign Het
Tnk2 G A 16: 32,680,142 V758I probably damaging Het
Trim72 A G 7: 128,009,082 I251V probably benign Het
Trip12 T A 1: 84,728,145 N655Y probably damaging Het
Ttn A G 2: 76,751,429 V23040A probably damaging Het
Tulp2 T A 7: 45,517,943 N188K probably damaging Het
Ube2c C T 2: 164,771,362 H67Y probably damaging Het
Unc80 C A 1: 66,631,414 P1899T possibly damaging Het
Usp34 C T 11: 23,426,153 A1879V probably benign Het
Vmn2r118 G A 17: 55,611,556 S112L possibly damaging Het
Zcchc4 A G 5: 52,815,826 Y344C probably damaging Het
Zdbf2 GAAAAA GAAAAAA 1: 63,305,542 probably null Het
Zdhhc25 A T 15: 88,600,486 H8L probably benign Het
Zfp455 A T 13: 67,207,817 H383L probably damaging Het
Zfp663 A G 2: 165,353,291 I336T probably benign Het
Zfp738 T A 13: 67,670,357 H505L probably damaging Het
Zfp84 T G 7: 29,775,371 F23V possibly damaging Het
Other mutations in Wdfy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Wdfy3 APN 5 101915338 critical splice donor site probably null
IGL00567:Wdfy3 APN 5 101912030 splice site probably benign
IGL01288:Wdfy3 APN 5 101901991 splice site probably null
IGL01323:Wdfy3 APN 5 101895064 missense probably damaging 1.00
IGL01352:Wdfy3 APN 5 101944120 missense probably damaging 1.00
IGL01553:Wdfy3 APN 5 101900031 missense probably benign
IGL01560:Wdfy3 APN 5 101957486 nonsense probably null
IGL01566:Wdfy3 APN 5 101896588 splice site probably benign
IGL01616:Wdfy3 APN 5 101913260 missense probably damaging 0.97
IGL01630:Wdfy3 APN 5 101907488 missense probably benign
IGL01791:Wdfy3 APN 5 101937412 missense probably damaging 1.00
IGL01820:Wdfy3 APN 5 101924081 missense probably benign 0.11
IGL01953:Wdfy3 APN 5 101895028 nonsense probably null
IGL02121:Wdfy3 APN 5 101898510 missense possibly damaging 0.85
IGL02167:Wdfy3 APN 5 101961157 missense probably damaging 0.98
IGL02321:Wdfy3 APN 5 101922609 missense probably damaging 0.99
IGL02327:Wdfy3 APN 5 101888192 missense probably damaging 1.00
IGL02651:Wdfy3 APN 5 101896475 missense probably benign 0.37
IGL02801:Wdfy3 APN 5 101907587 missense probably damaging 1.00
IGL02839:Wdfy3 APN 5 101968920 missense probably damaging 1.00
IGL02870:Wdfy3 APN 5 101855471 missense probably damaging 1.00
IGL02997:Wdfy3 APN 5 101894912 missense probably null 1.00
IGL03064:Wdfy3 APN 5 101935997 missense probably damaging 0.99
IGL03090:Wdfy3 APN 5 101866276 missense probably damaging 1.00
IGL03211:Wdfy3 APN 5 101844912 splice site probably benign
IGL03237:Wdfy3 APN 5 101844599 missense probably damaging 1.00
IGL03264:Wdfy3 APN 5 101900150 missense probably damaging 1.00
Esurient UTSW 5 101944103 missense probably damaging 1.00
IGL02988:Wdfy3 UTSW 5 101929981 missense probably damaging 0.99
PIT4382001:Wdfy3 UTSW 5 101882961 frame shift probably null
R0010:Wdfy3 UTSW 5 101848349 missense probably damaging 1.00
R0010:Wdfy3 UTSW 5 101848349 missense probably damaging 1.00
R0025:Wdfy3 UTSW 5 101845046 missense probably damaging 0.98
R0031:Wdfy3 UTSW 5 101889295 missense probably damaging 0.97
R0047:Wdfy3 UTSW 5 101944033 missense probably damaging 1.00
R0047:Wdfy3 UTSW 5 101944033 missense probably damaging 1.00
R0053:Wdfy3 UTSW 5 101844614 missense probably damaging 0.97
R0078:Wdfy3 UTSW 5 101888105 missense possibly damaging 0.57
R0147:Wdfy3 UTSW 5 101917411 missense probably benign 0.05
R0148:Wdfy3 UTSW 5 101917411 missense probably benign 0.05
R0279:Wdfy3 UTSW 5 101868092 missense probably damaging 1.00
R0380:Wdfy3 UTSW 5 101948966 missense probably damaging 0.99
R0472:Wdfy3 UTSW 5 101957443 missense probably benign 0.13
R0513:Wdfy3 UTSW 5 101890789 missense probably damaging 0.96
R0594:Wdfy3 UTSW 5 101906185 missense possibly damaging 0.94
R0601:Wdfy3 UTSW 5 101836172 missense probably benign
R0787:Wdfy3 UTSW 5 101957388 missense probably damaging 1.00
R0825:Wdfy3 UTSW 5 101870051 missense probably damaging 1.00
R1122:Wdfy3 UTSW 5 101882966 missense possibly damaging 0.94
R1167:Wdfy3 UTSW 5 101875931 missense probably benign
R1350:Wdfy3 UTSW 5 101898552 missense probably damaging 1.00
R1422:Wdfy3 UTSW 5 101884214 splice site probably benign
R1446:Wdfy3 UTSW 5 101851310 missense possibly damaging 0.68
R1452:Wdfy3 UTSW 5 101937738 missense possibly damaging 0.91
R1457:Wdfy3 UTSW 5 101917579 missense possibly damaging 0.57
R1543:Wdfy3 UTSW 5 101844081 missense probably benign
R1633:Wdfy3 UTSW 5 101981548 missense probably damaging 1.00
R1643:Wdfy3 UTSW 5 101875915 missense possibly damaging 0.62
R1656:Wdfy3 UTSW 5 101941447 missense probably damaging 1.00
R1720:Wdfy3 UTSW 5 101926525 frame shift probably null
R1743:Wdfy3 UTSW 5 101844065 missense probably benign 0.12
R1745:Wdfy3 UTSW 5 101948929 missense probably damaging 0.96
R1850:Wdfy3 UTSW 5 101894999 missense probably damaging 1.00
R1852:Wdfy3 UTSW 5 101915376 missense probably benign 0.00
R1880:Wdfy3 UTSW 5 101917435 missense probably benign 0.05
R1930:Wdfy3 UTSW 5 101941492 missense probably damaging 1.00
R1931:Wdfy3 UTSW 5 101941492 missense probably damaging 1.00
R1956:Wdfy3 UTSW 5 101919409 missense probably benign 0.30
R1965:Wdfy3 UTSW 5 101951312 missense probably damaging 1.00
R1997:Wdfy3 UTSW 5 101968946 missense probably damaging 1.00
R2015:Wdfy3 UTSW 5 101860486 missense probably null 1.00
R2087:Wdfy3 UTSW 5 101895060 missense probably damaging 1.00
R2156:Wdfy3 UTSW 5 101898425 critical splice donor site probably null
R2192:Wdfy3 UTSW 5 101907542 missense possibly damaging 0.55
R2313:Wdfy3 UTSW 5 101889284 missense probably damaging 1.00
R2332:Wdfy3 UTSW 5 101888323 splice site probably benign
R2406:Wdfy3 UTSW 5 101888259 missense probably damaging 1.00
R2679:Wdfy3 UTSW 5 101870036 missense probably damaging 1.00
R2857:Wdfy3 UTSW 5 101875930 missense probably benign 0.04
R2937:Wdfy3 UTSW 5 101944122 missense probably benign 0.07
R3765:Wdfy3 UTSW 5 101861400 missense probably damaging 1.00
R3795:Wdfy3 UTSW 5 101937600 missense probably damaging 1.00
R3937:Wdfy3 UTSW 5 101944239 nonsense probably null
R3947:Wdfy3 UTSW 5 101870036 missense probably damaging 1.00
R4024:Wdfy3 UTSW 5 101924095 splice site probably benign
R4065:Wdfy3 UTSW 5 101922447 missense probably benign 0.08
R4066:Wdfy3 UTSW 5 101922447 missense probably benign 0.08
R4110:Wdfy3 UTSW 5 101900058 critical splice donor site probably null
R4235:Wdfy3 UTSW 5 101922634 critical splice acceptor site probably null
R4420:Wdfy3 UTSW 5 101910984 missense probably damaging 0.97
R4620:Wdfy3 UTSW 5 101906145 missense probably damaging 0.99
R4624:Wdfy3 UTSW 5 101884083 missense possibly damaging 0.52
R4626:Wdfy3 UTSW 5 101943934 missense probably damaging 1.00
R4727:Wdfy3 UTSW 5 101930028 missense probably damaging 0.99
R4794:Wdfy3 UTSW 5 101943943 missense probably damaging 1.00
R4869:Wdfy3 UTSW 5 101894921 missense probably damaging 0.98
R4971:Wdfy3 UTSW 5 101948972 nonsense probably null
R4973:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R4976:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R4984:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R4986:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R5068:Wdfy3 UTSW 5 101894937 missense probably benign 0.15
R5105:Wdfy3 UTSW 5 101855549 missense probably damaging 1.00
R5120:Wdfy3 UTSW 5 101868106 missense possibly damaging 0.85
R5134:Wdfy3 UTSW 5 101944103 missense probably damaging 1.00
R5139:Wdfy3 UTSW 5 101849267 critical splice donor site probably null
R5235:Wdfy3 UTSW 5 101847106 missense probably null 0.03
R5303:Wdfy3 UTSW 5 101952983 missense probably damaging 1.00
R5368:Wdfy3 UTSW 5 101872858 missense probably damaging 1.00
R5426:Wdfy3 UTSW 5 101919446 missense probably damaging 0.97
R5442:Wdfy3 UTSW 5 101896559 missense probably benign 0.04
R5487:Wdfy3 UTSW 5 101836274 missense probably damaging 1.00
R5509:Wdfy3 UTSW 5 101861448 missense possibly damaging 0.69
R5877:Wdfy3 UTSW 5 101869989 missense probably damaging 1.00
R5988:Wdfy3 UTSW 5 101884138 missense probably benign 0.00
R6017:Wdfy3 UTSW 5 101851359 missense probably benign 0.01
R6019:Wdfy3 UTSW 5 101849423 missense probably damaging 1.00
R6199:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6228:Wdfy3 UTSW 5 101898429 missense possibly damaging 0.67
R6258:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6259:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6298:Wdfy3 UTSW 5 101968946 missense probably damaging 1.00
R6479:Wdfy3 UTSW 5 101913179 missense probably damaging 1.00
R6550:Wdfy3 UTSW 5 101953166 missense probably benign 0.19
R6776:Wdfy3 UTSW 5 101884045 missense possibly damaging 0.57
R6793:Wdfy3 UTSW 5 101917431 nonsense probably null
R6809:Wdfy3 UTSW 5 101923947 missense possibly damaging 0.63
R6836:Wdfy3 UTSW 5 101952999 missense probably damaging 1.00
R6897:Wdfy3 UTSW 5 101844066 missense probably benign 0.10
R7014:Wdfy3 UTSW 5 101894909 critical splice donor site probably null
R7034:Wdfy3 UTSW 5 101907518 missense probably damaging 1.00
R7035:Wdfy3 UTSW 5 101855549 missense probably damaging 1.00
R7135:Wdfy3 UTSW 5 101915437 missense probably damaging 1.00
R7182:Wdfy3 UTSW 5 101943892 missense possibly damaging 0.51
R7217:Wdfy3 UTSW 5 101901919 missense probably damaging 1.00
R7236:Wdfy3 UTSW 5 101836208 missense probably damaging 0.99
R7264:Wdfy3 UTSW 5 101855523 missense probably benign 0.02
R7418:Wdfy3 UTSW 5 101957500 missense probably benign 0.08
R7533:Wdfy3 UTSW 5 101882488 missense probably benign 0.27
R7543:Wdfy3 UTSW 5 101936059 missense probably benign 0.00
R7788:Wdfy3 UTSW 5 101848357 missense probably damaging 0.99
R7810:Wdfy3 UTSW 5 101895074 missense probably benign 0.01
R7810:Wdfy3 UTSW 5 101951399 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCCTGTACAGCTTTCATAAAGTG -3'
(R):5'- AACGACAGTGGGGATTTGC -3'

Sequencing Primer
(F):5'- TGTACAGCTTTCATAAAGTGGTAAAC -3'
(R):5'- AACGACAGTGGGGATTTGCATTTC -3'
Posted On2014-06-23