Mutagenetix > Incidental Mutation

Incidental Mutation 'R1855:A830018L16Rik'

205997

Institutional Source

Beutler Lab

Gene Symbol

A830018L16Rik

Ensembl Gene

ENSMUSG00000057715

Gene Name

RIKEN cDNA A830018L16 gene

Synonyms

MMRRC Submission

039879-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R1855 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

11414105-11975901 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 11747971 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 285 (L285Q)

Ref Sequence

ENSEMBL: ENSMUSP00000137287 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048613] [ENSMUST00000137824] [ENSMUST00000141512] [ENSMUST00000179089]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000048613
AA Change: L285Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000043857
Gene: ENSMUSG00000057715
AA Change: L285Q

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC
low complexity region	233	248	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000137824
AA Change: L285Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000117421
Gene: ENSMUSG00000057715
AA Change: L285Q

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC
low complexity region	233	248	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141512

SMART Domains

Protein: ENSMUSP00000139635
Gene: ENSMUSG00000057715

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000179089
AA Change: L285Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 97.4%
3x: 96.9%
10x: 95.3%
20x: 92.4%

Validation Efficiency

97% (72/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to the cyclic AMP dependent protein kinase regulators. Naturally occurring mutations in this gene are associated with an increased risk for severe toxicities, such as diarrhea and neutropenia, in patients undergoing chemotherapeutic treatment. [provided by RefSeq, Mar 2017]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	T	C	11: 84,371,554	L1994P	probably damaging	Het
Adamts9	A	G	6: 92,901,369		probably benign	Het
Aff3	T	C	1: 38,210,304	E574G	probably benign	Het
Ankrd1	T	C	19: 36,119,235	K64R	probably damaging	Het
Arhgap23	T	C	11: 97,448,697	I163T	probably damaging	Het
Ascc3	A	T	10: 50,617,922	Q151L	probably benign	Het
Atad2	G	A	15: 58,097,289	P971L	possibly damaging	Het
C1s1	A	C	6: 124,534,356		probably null	Het
Ccdc150	T	C	1: 54,367,910		probably benign	Het
Cdhr3	A	T	12: 33,060,352	I311N	probably damaging	Het
Chad	T	A	11: 94,565,477	L127H	probably damaging	Het
Clasp1	G	A	1: 118,508,894	A303T	probably damaging	Het
Clptm1	A	G	7: 19,638,209	V234A	probably benign	Het
Cnih3	C	A	1: 181,454,621	S140*	probably null	Het
Col24a1	G	A	3: 145,459,140	G1033D	probably damaging	Het
Csnk1a1	T	A	18: 61,575,427		probably null	Het
Cttnbp2	T	A	6: 18,378,413	I1475L	probably benign	Het
Dnah5	T	C	15: 28,411,669	V3728A	possibly damaging	Het
Dock9	C	A	14: 121,640,159	V391F	probably damaging	Het
Ehmt2	A	T	17: 34,910,776	I949F	probably damaging	Het
Eif4g1	C	A	16: 20,687,161	T1025K	possibly damaging	Het
Enpp2	C	T	15: 54,845,823	E803K	probably damaging	Het
Esrrg	A	T	1: 188,211,098	M423L	probably damaging	Het
Etnppl	A	T	3: 130,620,722	I89F	probably benign	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam122b	T	A	X: 53,254,056	Q201H	probably benign	Het
Fbln7	A	G	2: 128,893,835	T248A	possibly damaging	Het
Galnt9	C	T	5: 110,615,524	T465M	probably damaging	Het
Grcc10	A	G	6: 124,740,578	V57A	probably benign	Het
Herc1	T	A	9: 66,391,426	M614K	possibly damaging	Het
Itch	C	T	2: 155,172,454		probably benign	Het
Kdm6b	C	A	11: 69,407,286	A167S	probably damaging	Het
Kidins220	C	T	12: 25,056,591	R1348C	probably damaging	Het
Kif17	T	C	4: 138,288,271	L577P	probably benign	Het
Krt25	A	T	11: 99,318,315	L258Q	probably damaging	Het
March10	T	C	11: 105,390,392	T356A	probably benign	Het
Mical2	G	A	7: 112,345,282	A940T	probably benign	Het
Mrpl4	A	G	9: 21,003,371	E81G	possibly damaging	Het
Mtcl1	A	G	17: 66,379,514	V447A	probably benign	Het
Mtor	C	A	4: 148,553,089	N2502K	probably benign	Het
Notch4	G	A	17: 34,580,962	D966N	probably benign	Het
Oip5	C	A	2: 119,611,790	K214N	probably benign	Het
Olfr160	A	T	9: 37,711,970	F103Y	possibly damaging	Het
Pak7	A	T	2: 136,087,509	S585T	probably benign	Het
Pard3	T	A	8: 127,447,812		probably null	Het
Pcnx2	A	T	8: 125,807,996		probably benign	Het
Pcsk5	T	C	19: 17,515,192	Y939C	possibly damaging	Het
Pde1a	A	G	2: 79,898,064		probably null	Het
Pde9a	C	T	17: 31,455,120	P60S	probably damaging	Het
Pikfyve	C	A	1: 65,258,798	T1562K	probably benign	Het
Plekhg6	A	T	6: 125,375,839	M115K	probably damaging	Het
Pogz	C	T	3: 94,878,849	T863I	probably benign	Het
Ppp1r3a	A	T	6: 14,754,994	W85R	probably damaging	Het
Rnf123	C	A	9: 108,061,791	R826L	probably damaging	Het
Slc1a6	T	A	10: 78,812,924	V493E	probably damaging	Het
Slc22a2	A	G	17: 12,586,812	D150G	probably damaging	Het
Snap47	C	T	11: 59,428,333		probably benign	Het
Spata22	A	G	11: 73,340,559	D213G	probably benign	Het
St6galnac2	T	A	11: 116,690,315	R60S	probably benign	Het
Stk32c	A	G	7: 139,121,447	F263S	probably damaging	Het
Supt6	T	C	11: 78,232,540	I104V	possibly damaging	Het
Tex2	T	C	11: 106,546,876	E158G	possibly damaging	Het
Tiam2	C	T	17: 3,415,135	R380C	probably damaging	Het
Trim25	C	T	11: 89,015,581	T410I	probably benign	Het
Usp18	T	A	6: 121,262,117	C212S	probably benign	Het
Vmn1r2	A	G	4: 3,172,588	Y169C	probably damaging	Het
Wdr33	A	T	18: 31,906,856		probably benign	Het
Xpr1	A	G	1: 155,283,256	Y597H	probably benign	Het
Yy1	CGGG	CGGGGGGGGG	12: 108,793,990		probably benign	Het
Zfp54	T	A	17: 21,434,142	Y299*	probably null	Het
Zfp566	T	G	7: 30,078,502	S85R	probably benign	Het

Other mutations in A830018L16Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00426:A830018L16Rik	APN	1	11748054	missense	probably damaging	0.98
IGL01916:A830018L16Rik	APN	1	11748107	splice site	probably benign
IGL02040:A830018L16Rik	APN	1	11933598	intron	probably benign
IGL02432:A830018L16Rik	APN	1	11748079	missense	probably damaging	1.00
IGL02693:A830018L16Rik	APN	1	11596282	missense	probably damaging	1.00
IGL02736:A830018L16Rik	APN	1	11972051	missense	probably benign	0.02
IGL03293:A830018L16Rik	APN	1	11545151	splice site	probably null
IGL02835:A830018L16Rik	UTSW	1	11972055	missense	possibly damaging	0.54
R1203:A830018L16Rik	UTSW	1	11518594	missense	probably damaging	1.00
R1216:A830018L16Rik	UTSW	1	11798492	missense	probably damaging	0.99
R1548:A830018L16Rik	UTSW	1	11518594	missense	probably damaging	1.00
R1644:A830018L16Rik	UTSW	1	11414590	nonsense	probably null
R1858:A830018L16Rik	UTSW	1	11974953	missense	unknown
R2265:A830018L16Rik	UTSW	1	11972104	critical splice donor site	probably null
R2296:A830018L16Rik	UTSW	1	11512051	missense	possibly damaging	0.94
R2484:A830018L16Rik	UTSW	1	11596302	missense	probably damaging	1.00
R3730:A830018L16Rik	UTSW	1	11545226	missense	probably damaging	1.00
R3752:A830018L16Rik	UTSW	1	11518680	missense	probably damaging	1.00
R3861:A830018L16Rik	UTSW	1	11588554	splice site	probably benign
R4305:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4306:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4307:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4558:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4598:A830018L16Rik	UTSW	1	11747964	critical splice acceptor site	probably null
R4652:A830018L16Rik	UTSW	1	11537342	intron	probably benign
R5492:A830018L16Rik	UTSW	1	11545207	missense	probably damaging	0.99
R5493:A830018L16Rik	UTSW	1	11545207	missense	probably damaging	0.99
R5802:A830018L16Rik	UTSW	1	11950964	missense	probably damaging	1.00
R6007:A830018L16Rik	UTSW	1	11511916	critical splice acceptor site	probably null
R6082:A830018L16Rik	UTSW	1	11798528	missense	probably benign	0.04
R6376:A830018L16Rik	UTSW	1	11798494	missense	probably damaging	0.98
R6453:A830018L16Rik	UTSW	1	11798558	missense	possibly damaging	0.91
R6757:A830018L16Rik	UTSW	1	11596334	makesense	probably null
R6833:A830018L16Rik	UTSW	1	11588509	missense	probably damaging	1.00
R7163:A830018L16Rik	UTSW	1	11414624	missense	probably damaging	0.96
R7272:A830018L16Rik	UTSW	1	11588471	missense	probably damaging	0.97
R7566:A830018L16Rik	UTSW	1	11951028	missense	probably damaging	1.00
R7665:A830018L16Rik	UTSW	1	11972099	missense	probably damaging	0.96
R8004:A830018L16Rik	UTSW	1	11951062	splice site	probably benign
R8754:A830018L16Rik	UTSW	1	11545248	missense	probably benign	0.33
R8944:A830018L16Rik	UTSW	1	11414482	unclassified	probably benign
R8993:A830018L16Rik	UTSW	1	11545267	nonsense	probably null
R8997:A830018L16Rik	UTSW	1	11545267	nonsense	probably null
R9098:A830018L16Rik	UTSW	1	11562987	missense	probably damaging	1.00
R9640:A830018L16Rik	UTSW	1	11950976	missense	probably damaging	0.98
R9704:A830018L16Rik	UTSW	1	11518689	missense	probably damaging	1.00
R9705:A830018L16Rik	UTSW	1	11518689	missense	probably damaging	1.00
Z1176:A830018L16Rik	UTSW	1	11518625	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AGCCCCTCAAACTGTAGGTG -3'
(R):5'- ACAGTACCCTCTTTGCATCAAAATC -3'

Sequencing Primer
(F):5'- CCCTCAAACTGTAGGTGGATGAGTC -3'
(R):5'- ACCCTCTTTGCATCAAAATCTTAGC -3'

Posted On

2014-06-23