Incidental Mutation 'R1855:Mical2'
ID 206027
Institutional Source Beutler Lab
Gene Symbol Mical2
Ensembl Gene ENSMUSG00000038244
Gene Name microtubule associated monooxygenase, calponin and LIM domain containing 2
Synonyms 5330438E18Rik
MMRRC Submission 039879-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock # R1855 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 112225856-112355194 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 112345282 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 940 (A940T)
Ref Sequence ENSEMBL: ENSMUSP00000047639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037991] [ENSMUST00000050149]
AlphaFold Q8BML1
Q9D5U9
Predicted Effect probably benign
Transcript: ENSMUST00000037991
AA Change: A940T

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000047639
Gene: ENSMUSG00000038244
AA Change: A940T

DomainStartEndE-ValueType
Pfam:FAD_binding_3 86 143 1e-8 PFAM
Pfam:FAD_binding_2 88 127 3.2e-6 PFAM
low complexity region 175 188 N/A INTRINSIC
low complexity region 500 515 N/A INTRINSIC
CH 518 617 4.14e-17 SMART
low complexity region 691 700 N/A INTRINSIC
low complexity region 894 925 N/A INTRINSIC
LIM 979 1033 9.91e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050149
SMART Domains Protein: ENSMUSP00000051163
Gene: ENSMUSG00000038244

DomainStartEndE-ValueType
Pfam:FAD_binding_3 86 143 1.1e-8 PFAM
Pfam:FAD_binding_2 88 127 1.5e-6 PFAM
Pfam:Pyr_redox_2 88 259 1.3e-6 PFAM
low complexity region 500 515 N/A INTRINSIC
CH 518 617 4.14e-17 SMART
low complexity region 691 700 N/A INTRINSIC
LIM 752 806 9.91e-10 SMART
low complexity region 918 926 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106648
SMART Domains Protein: ENSMUSP00000102259
Gene: ENSMUSG00000038244

DomainStartEndE-ValueType
Pfam:FAD_binding_3 86 143 9.5e-9 PFAM
Pfam:FAD_binding_2 88 127 1.3e-6 PFAM
Pfam:Pyr_redox_2 88 263 1e-6 PFAM
low complexity region 500 515 N/A INTRINSIC
CH 518 617 4.14e-17 SMART
low complexity region 691 700 N/A INTRINSIC
LIM 752 806 1.71e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144509
SMART Domains Protein: ENSMUSP00000123341
Gene: ENSMUSG00000038244

DomainStartEndE-ValueType
LIM 14 68 9.91e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150428
Predicted Effect probably benign
Transcript: ENSMUST00000215412
Predicted Effect probably benign
Transcript: ENSMUST00000216652
Meta Mutation Damage Score 0.0909 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a monooxygenase that enhances depolymerization of F-actin and is therefore involved in cytoskeletal dynamics. The encoded protein is a regulator of the SRF signaling pathway. Increased expression of this gene has been associated with cancer progression and metastasis. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,747,971 L285Q probably damaging Het
Acaca T C 11: 84,371,554 L1994P probably damaging Het
Adamts9 A G 6: 92,901,369 probably benign Het
Aff3 T C 1: 38,210,304 E574G probably benign Het
Ankrd1 T C 19: 36,119,235 K64R probably damaging Het
Arhgap23 T C 11: 97,448,697 I163T probably damaging Het
Ascc3 A T 10: 50,617,922 Q151L probably benign Het
Atad2 G A 15: 58,097,289 P971L possibly damaging Het
C1s1 A C 6: 124,534,356 probably null Het
Ccdc150 T C 1: 54,367,910 probably benign Het
Cdhr3 A T 12: 33,060,352 I311N probably damaging Het
Chad T A 11: 94,565,477 L127H probably damaging Het
Clasp1 G A 1: 118,508,894 A303T probably damaging Het
Clptm1 A G 7: 19,638,209 V234A probably benign Het
Cnih3 C A 1: 181,454,621 S140* probably null Het
Col24a1 G A 3: 145,459,140 G1033D probably damaging Het
Csnk1a1 T A 18: 61,575,427 probably null Het
Cttnbp2 T A 6: 18,378,413 I1475L probably benign Het
Dnah5 T C 15: 28,411,669 V3728A possibly damaging Het
Dock9 C A 14: 121,640,159 V391F probably damaging Het
Ehmt2 A T 17: 34,910,776 I949F probably damaging Het
Eif4g1 C A 16: 20,687,161 T1025K possibly damaging Het
Enpp2 C T 15: 54,845,823 E803K probably damaging Het
Esrrg A T 1: 188,211,098 M423L probably damaging Het
Etnppl A T 3: 130,620,722 I89F probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam122b T A X: 53,254,056 Q201H probably benign Het
Fbln7 A G 2: 128,893,835 T248A possibly damaging Het
Galnt9 C T 5: 110,615,524 T465M probably damaging Het
Grcc10 A G 6: 124,740,578 V57A probably benign Het
Herc1 T A 9: 66,391,426 M614K possibly damaging Het
Itch C T 2: 155,172,454 probably benign Het
Kdm6b C A 11: 69,407,286 A167S probably damaging Het
Kidins220 C T 12: 25,056,591 R1348C probably damaging Het
Kif17 T C 4: 138,288,271 L577P probably benign Het
Krt25 A T 11: 99,318,315 L258Q probably damaging Het
March10 T C 11: 105,390,392 T356A probably benign Het
Mrpl4 A G 9: 21,003,371 E81G possibly damaging Het
Mtcl1 A G 17: 66,379,514 V447A probably benign Het
Mtor C A 4: 148,553,089 N2502K probably benign Het
Notch4 G A 17: 34,580,962 D966N probably benign Het
Oip5 C A 2: 119,611,790 K214N probably benign Het
Olfr160 A T 9: 37,711,970 F103Y possibly damaging Het
Pak7 A T 2: 136,087,509 S585T probably benign Het
Pard3 T A 8: 127,447,812 probably null Het
Pcnx2 A T 8: 125,807,996 probably benign Het
Pcsk5 T C 19: 17,515,192 Y939C possibly damaging Het
Pde1a A G 2: 79,898,064 probably null Het
Pde9a C T 17: 31,455,120 P60S probably damaging Het
Pikfyve C A 1: 65,258,798 T1562K probably benign Het
Plekhg6 A T 6: 125,375,839 M115K probably damaging Het
Pogz C T 3: 94,878,849 T863I probably benign Het
Ppp1r3a A T 6: 14,754,994 W85R probably damaging Het
Rnf123 C A 9: 108,061,791 R826L probably damaging Het
Slc1a6 T A 10: 78,812,924 V493E probably damaging Het
Slc22a2 A G 17: 12,586,812 D150G probably damaging Het
Snap47 C T 11: 59,428,333 probably benign Het
Spata22 A G 11: 73,340,559 D213G probably benign Het
St6galnac2 T A 11: 116,690,315 R60S probably benign Het
Stk32c A G 7: 139,121,447 F263S probably damaging Het
Supt6 T C 11: 78,232,540 I104V possibly damaging Het
Tex2 T C 11: 106,546,876 E158G possibly damaging Het
Tiam2 C T 17: 3,415,135 R380C probably damaging Het
Trim25 C T 11: 89,015,581 T410I probably benign Het
Usp18 T A 6: 121,262,117 C212S probably benign Het
Vmn1r2 A G 4: 3,172,588 Y169C probably damaging Het
Wdr33 A T 18: 31,906,856 probably benign Het
Xpr1 A G 1: 155,283,256 Y597H probably benign Het
Yy1 CGGG CGGGGGGGGG 12: 108,793,990 probably benign Het
Zfp54 T A 17: 21,434,142 Y299* probably null Het
Zfp566 T G 7: 30,078,502 S85R probably benign Het
Other mutations in Mical2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Mical2 APN 7 112315072 missense probably benign 0.00
IGL00934:Mical2 APN 7 112349403 missense probably damaging 1.00
IGL00941:Mical2 APN 7 112321445 splice site probably benign
IGL01020:Mical2 APN 7 112315076 splice site probably benign
IGL01395:Mical2 APN 7 112323585 missense probably damaging 1.00
IGL01658:Mical2 APN 7 112314998 missense probably damaging 1.00
IGL02040:Mical2 APN 7 112311406 missense probably damaging 1.00
IGL02388:Mical2 APN 7 112335413 missense probably benign
IGL02551:Mical2 APN 7 112323990 missense probably benign 0.01
IGL02578:Mical2 APN 7 112351373 missense probably benign 0.05
IGL02751:Mical2 APN 7 112332036 missense probably benign 0.11
R0101:Mical2 UTSW 7 112336867 missense possibly damaging 0.86
R0504:Mical2 UTSW 7 112271317 missense probably benign 0.00
R0594:Mical2 UTSW 7 112318450 missense probably damaging 0.97
R0609:Mical2 UTSW 7 112321440 splice site probably null
R1542:Mical2 UTSW 7 112309468 missense probably damaging 1.00
R1740:Mical2 UTSW 7 112333836 missense probably benign
R2086:Mical2 UTSW 7 112318603 missense probably benign 0.31
R2136:Mical2 UTSW 7 112271515 missense possibly damaging 0.72
R2418:Mical2 UTSW 7 112320734 critical splice donor site probably null
R3053:Mical2 UTSW 7 112311423 missense probably damaging 1.00
R4308:Mical2 UTSW 7 112331992 missense probably benign 0.27
R4663:Mical2 UTSW 7 112328677 missense possibly damaging 0.80
R4868:Mical2 UTSW 7 112318624 missense probably damaging 1.00
R4902:Mical2 UTSW 7 112336900 missense probably benign
R5112:Mical2 UTSW 7 112320611 missense probably damaging 1.00
R5487:Mical2 UTSW 7 112320635 missense probably damaging 1.00
R5563:Mical2 UTSW 7 112314978 missense probably damaging 1.00
R5817:Mical2 UTSW 7 112323659 missense probably benign
R5987:Mical2 UTSW 7 112334948 missense probably benign 0.00
R6087:Mical2 UTSW 7 112318485 nonsense probably null
R6209:Mical2 UTSW 7 112324086 splice site probably null
R6311:Mical2 UTSW 7 112323558 missense probably damaging 1.00
R6319:Mical2 UTSW 7 112328677 missense possibly damaging 0.80
R6578:Mical2 UTSW 7 112311445 missense probably damaging 1.00
R6782:Mical2 UTSW 7 112346761 missense probably damaging 1.00
R7061:Mical2 UTSW 7 112346801 missense probably benign 0.10
R7147:Mical2 UTSW 7 112323603 missense possibly damaging 0.77
R7260:Mical2 UTSW 7 112319794 missense probably benign 0.10
R7266:Mical2 UTSW 7 112303756 missense probably damaging 1.00
R7391:Mical2 UTSW 7 112320609 missense probably damaging 1.00
R7724:Mical2 UTSW 7 112323626 missense probably damaging 1.00
R7747:Mical2 UTSW 7 112333839 missense probably benign 0.02
R7818:Mical2 UTSW 7 112345307 missense probably damaging 1.00
R8022:Mical2 UTSW 7 112303767 missense probably damaging 1.00
R8429:Mical2 UTSW 7 112345253 missense probably benign 0.01
R8505:Mical2 UTSW 7 112319800 missense probably benign 0.02
R8532:Mical2 UTSW 7 112318544 missense probably damaging 1.00
R8862:Mical2 UTSW 7 112311367 missense probably damaging 1.00
R8988:Mical2 UTSW 7 112311454 missense possibly damaging 0.63
R9123:Mical2 UTSW 7 112271382 missense possibly damaging 0.61
R9127:Mical2 UTSW 7 112271382 missense possibly damaging 0.61
R9128:Mical2 UTSW 7 112271382 missense possibly damaging 0.61
R9129:Mical2 UTSW 7 112271382 missense possibly damaging 0.61
R9187:Mical2 UTSW 7 112303590 nonsense probably null
R9310:Mical2 UTSW 7 112351713 missense probably benign 0.45
R9399:Mical2 UTSW 7 112346875 missense probably damaging 1.00
R9500:Mical2 UTSW 7 112336847 critical splice acceptor site probably null
R9652:Mical2 UTSW 7 112346789 missense probably damaging 1.00
R9657:Mical2 UTSW 7 112322599 missense probably benign 0.37
R9756:Mical2 UTSW 7 112303721 missense probably damaging 0.99
R9789:Mical2 UTSW 7 112346789 missense probably damaging 1.00
RF008:Mical2 UTSW 7 112323626 missense probably damaging 1.00
X0062:Mical2 UTSW 7 112346843 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTGGCATCTACTCCTGG -3'
(R):5'- CTGGATCCAGCCGACTTTCAAC -3'

Sequencing Primer
(F):5'- GGCATCTACTCCTGGTGGTC -3'
(R):5'- GCCGACTTTCAACACCCCTG -3'
Posted On 2014-06-23