Mutagenetix > Incidental Mutation

Incidental Mutation 'R6007:A830018L16Rik'

479514

Institutional Source

Beutler Lab

Gene Symbol

A830018L16Rik

Ensembl Gene

ENSMUSG00000057715

Gene Name

RIKEN cDNA A830018L16 gene

Synonyms

MMRRC Submission

044184-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R6007 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

11414105-11975901 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to G at 11511916 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000137287 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048613] [ENSMUST00000135014] [ENSMUST00000135014] [ENSMUST00000137824] [ENSMUST00000141512] [ENSMUST00000171690] [ENSMUST00000171690] [ENSMUST00000179089] [ENSMUST00000179089]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000048613

SMART Domains

Protein: ENSMUSP00000043857
Gene: ENSMUSG00000057715

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC
low complexity region	233	248	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000135014

SMART Domains

Protein: ENSMUSP00000119143
Gene: ENSMUSG00000057715

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC
low complexity region	233	248	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000135014

SMART Domains

Protein: ENSMUSP00000119143
Gene: ENSMUSG00000057715

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC
low complexity region	233	248	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000137824

SMART Domains

Protein: ENSMUSP00000117421
Gene: ENSMUSG00000057715

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC
low complexity region	233	248	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141512

SMART Domains

Protein: ENSMUSP00000139635
Gene: ENSMUSG00000057715

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142117

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150870

Predicted Effect

probably null
Transcript: ENSMUST00000171690

SMART Domains

Protein: ENSMUSP00000132334
Gene: ENSMUSG00000057715

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC
low complexity region	233	248	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000171690

SMART Domains

Protein: ENSMUSP00000132334
Gene: ENSMUSG00000057715

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC
low complexity region	233	248	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000179089

Predicted Effect

probably null
Transcript: ENSMUST00000179089

Meta Mutation Damage Score

0.9485

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.1%
20x: 90.6%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to the cyclic AMP dependent protein kinase regulators. Naturally occurring mutations in this gene are associated with an increased risk for severe toxicities, such as diarrhea and neutropenia, in patients undergoing chemotherapeutic treatment. [provided by RefSeq, Mar 2017]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	G	T	6: 83,160,918	A9S	possibly damaging	Het
4930407I10Rik	C	G	15: 82,062,739	T279S	probably benign	Het
Abcg5	T	G	17: 84,668,964	I482L	probably benign	Het
Adgrf5	T	A	17: 43,437,571	D44E	probably damaging	Het
Amh	A	G	10: 80,805,471	N75S	probably benign	Het
Arl8a	T	C	1: 135,152,868		probably null	Het
Bpifb4	T	C	2: 153,942,560	Y63H	possibly damaging	Het
Chd5	A	T	4: 152,379,421	E1449V	probably null	Het
Chml	A	G	1: 175,688,028	V109A	probably benign	Het
Crybg3	G	T	16: 59,554,474	S2139*	probably null	Het
Cyp2c68	T	C	19: 39,734,336	D256G	probably damaging	Het
Dchs2	G	T	3: 83,346,227	V2315L	probably damaging	Het
Ddx20	T	C	3: 105,683,420	I227V	possibly damaging	Het
Drg2	T	C	11: 60,462,625	V266A	possibly damaging	Het
Flcn	C	A	11: 59,792,622	E576D	probably benign	Het
Fstl5	T	A	3: 76,410,592	D188E	probably damaging	Het
Gm14496	A	G	2: 181,997,530	Q471R	probably benign	Het
Gm43772	T	C	5: 66,174,991		probably benign	Het
Gpc6	C	T	14: 117,951,261	H436Y	probably damaging	Het
Gpr179	A	T	11: 97,335,802	C1842*	probably null	Het
Ints8	G	A	4: 11,208,845	T934I	possibly damaging	Het
Iqsec1	G	T	6: 90,660,987	C1050*	probably null	Het
Larp4b	T	C	13: 9,168,757	V510A	probably benign	Het
Map3k13	A	T	16: 21,905,183	D305V	possibly damaging	Het
Mc5r	A	T	18: 68,339,247	I226F	possibly damaging	Het
Mme	G	A	3: 63,343,508	W323*	probably null	Het
Mrpl24	A	G	3: 87,922,398	Y97C	probably benign	Het
Mslnl	G	A	17: 25,746,775	S541N	probably benign	Het
Npepl1	T	C	2: 174,121,057	V412A	probably benign	Het
Nrg3	T	A	14: 39,472,452	K117*	probably null	Het
Olfr1275	T	C	2: 111,230,930	T288A	probably benign	Het
Olfr736	G	T	14: 50,393,491	C245F	probably damaging	Het
Orc2	A	T	1: 58,467,692	M447K	probably benign	Het
Phf3	A	T	1: 30,804,345	H1844Q	probably damaging	Het
Plxnc1	T	C	10: 94,793,290	I1541V	possibly damaging	Het
Rapgef4	T	C	2: 72,179,949	Y284H	possibly damaging	Het
Rnf180	C	A	13: 105,181,449		probably null	Het
Secisbp2	T	C	13: 51,665,359	I325T	probably damaging	Het
Sertad2	G	A	11: 20,647,884	G27S	probably benign	Het
Slc4a10	A	G	2: 62,268,872	M625V	probably benign	Het
Synpo	T	A	18: 60,603,615	M420L	probably benign	Het
Tmem116	A	C	5: 121,517,892	*147C	probably null	Het
Top2b	G	A	14: 16,423,779		probably null	Het
Trp53bp2	T	A	1: 182,455,740	C1014S	probably damaging	Het
Unc5b	A	G	10: 60,765,360	F896L	probably damaging	Het
Vil1	T	C	1: 74,419,867	W177R	probably damaging	Het
Vmn2r107	A	T	17: 20,375,054	Y623F	probably benign	Het
Vmn2r86	T	C	10: 130,453,666	Y120C	probably damaging	Het
Wdr18	A	G	10: 79,965,343	T197A	possibly damaging	Het
Ylpm1	A	G	12: 85,029,290	M472V	probably benign	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het
Zfp677	A	G	17: 21,397,656	Y325C	probably damaging	Het
Zfyve1	A	G	12: 83,558,704	F407S	probably damaging	Het

Other mutations in A830018L16Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00426:A830018L16Rik	APN	1	11748054	missense	probably damaging	0.98
IGL01916:A830018L16Rik	APN	1	11748107	splice site	probably benign
IGL02040:A830018L16Rik	APN	1	11933598	intron	probably benign
IGL02432:A830018L16Rik	APN	1	11748079	missense	probably damaging	1.00
IGL02693:A830018L16Rik	APN	1	11596282	missense	probably damaging	1.00
IGL02736:A830018L16Rik	APN	1	11972051	missense	probably benign	0.02
IGL03293:A830018L16Rik	APN	1	11545151	splice site	probably null
IGL02835:A830018L16Rik	UTSW	1	11972055	missense	possibly damaging	0.54
R1203:A830018L16Rik	UTSW	1	11518594	missense	probably damaging	1.00
R1216:A830018L16Rik	UTSW	1	11798492	missense	probably damaging	0.99
R1548:A830018L16Rik	UTSW	1	11518594	missense	probably damaging	1.00
R1644:A830018L16Rik	UTSW	1	11414590	nonsense	probably null
R1855:A830018L16Rik	UTSW	1	11747971	missense	probably damaging	1.00
R1858:A830018L16Rik	UTSW	1	11974953	missense	unknown
R2265:A830018L16Rik	UTSW	1	11972104	critical splice donor site	probably null
R2296:A830018L16Rik	UTSW	1	11512051	missense	possibly damaging	0.94
R2484:A830018L16Rik	UTSW	1	11596302	missense	probably damaging	1.00
R3730:A830018L16Rik	UTSW	1	11545226	missense	probably damaging	1.00
R3752:A830018L16Rik	UTSW	1	11518680	missense	probably damaging	1.00
R3861:A830018L16Rik	UTSW	1	11588554	splice site	probably benign
R4305:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4306:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4307:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4558:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4598:A830018L16Rik	UTSW	1	11747964	critical splice acceptor site	probably null
R4652:A830018L16Rik	UTSW	1	11537342	intron	probably benign
R5492:A830018L16Rik	UTSW	1	11545207	missense	probably damaging	0.99
R5493:A830018L16Rik	UTSW	1	11545207	missense	probably damaging	0.99
R5802:A830018L16Rik	UTSW	1	11950964	missense	probably damaging	1.00
R6082:A830018L16Rik	UTSW	1	11798528	missense	probably benign	0.04
R6376:A830018L16Rik	UTSW	1	11798494	missense	probably damaging	0.98
R6453:A830018L16Rik	UTSW	1	11798558	missense	possibly damaging	0.91
R6757:A830018L16Rik	UTSW	1	11596334	makesense	probably null
R6833:A830018L16Rik	UTSW	1	11588509	missense	probably damaging	1.00
R7163:A830018L16Rik	UTSW	1	11414624	missense	probably damaging	0.96
R7272:A830018L16Rik	UTSW	1	11588471	missense	probably damaging	0.97
R7566:A830018L16Rik	UTSW	1	11951028	missense	probably damaging	1.00
R7665:A830018L16Rik	UTSW	1	11972099	missense	probably damaging	0.96
R8004:A830018L16Rik	UTSW	1	11951062	splice site	probably benign
R8754:A830018L16Rik	UTSW	1	11545248	missense	probably benign	0.33
R8944:A830018L16Rik	UTSW	1	11414482	unclassified	probably benign
R8993:A830018L16Rik	UTSW	1	11545267	nonsense	probably null
R8997:A830018L16Rik	UTSW	1	11545267	nonsense	probably null
R9098:A830018L16Rik	UTSW	1	11562987	missense	probably damaging	1.00
R9640:A830018L16Rik	UTSW	1	11950976	missense	probably damaging	0.98
R9704:A830018L16Rik	UTSW	1	11518689	missense	probably damaging	1.00
R9705:A830018L16Rik	UTSW	1	11518689	missense	probably damaging	1.00
Z1176:A830018L16Rik	UTSW	1	11518625	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AATTCCAGCATGTTCTTTGGG -3'
(R):5'- ATTCAAAAGTTTGGTTTCCTCCACC -3'

Sequencing Primer
(F):5'- GTTTCTAATGGGATTCCTTGAAAGAG -3'
(R):5'- TCCACCCAATTACCTGATGATTCAC -3'

Posted On

2017-06-26