Incidental Mutation 'R6007:A830018L16Rik'
ID479514
Institutional Source Beutler Lab
Gene Symbol A830018L16Rik
Ensembl Gene ENSMUSG00000057715
Gene NameRIKEN cDNA A830018L16 gene
Synonyms
MMRRC Submission 044184-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6007 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location11414105-11975901 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 11511916 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048613] [ENSMUST00000135014] [ENSMUST00000135014] [ENSMUST00000137824] [ENSMUST00000141512] [ENSMUST00000171690] [ENSMUST00000171690] [ENSMUST00000179089] [ENSMUST00000179089]
Predicted Effect probably null
Transcript: ENSMUST00000048613
SMART Domains Protein: ENSMUSP00000043857
Gene: ENSMUSG00000057715

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
low complexity region 233 248 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135014
SMART Domains Protein: ENSMUSP00000119143
Gene: ENSMUSG00000057715

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
low complexity region 233 248 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135014
SMART Domains Protein: ENSMUSP00000119143
Gene: ENSMUSG00000057715

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
low complexity region 233 248 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000137824
SMART Domains Protein: ENSMUSP00000117421
Gene: ENSMUSG00000057715

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
low complexity region 233 248 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141512
SMART Domains Protein: ENSMUSP00000139635
Gene: ENSMUSG00000057715

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150870
Predicted Effect probably null
Transcript: ENSMUST00000171690
SMART Domains Protein: ENSMUSP00000132334
Gene: ENSMUSG00000057715

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
low complexity region 233 248 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171690
SMART Domains Protein: ENSMUSP00000132334
Gene: ENSMUSG00000057715

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
low complexity region 233 248 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000179089
Predicted Effect probably null
Transcript: ENSMUST00000179089
Meta Mutation Damage Score 0.9485 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.6%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to the cyclic AMP dependent protein kinase regulators. Naturally occurring mutations in this gene are associated with an increased risk for severe toxicities, such as diarrhea and neutropenia, in patients undergoing chemotherapeutic treatment. [provided by RefSeq, Mar 2017]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik G T 6: 83,160,918 A9S possibly damaging Het
4930407I10Rik C G 15: 82,062,739 T279S probably benign Het
Abcg5 T G 17: 84,668,964 I482L probably benign Het
Adgrf5 T A 17: 43,437,571 D44E probably damaging Het
Amh A G 10: 80,805,471 N75S probably benign Het
Arl8a T C 1: 135,152,868 probably null Het
Bpifb4 T C 2: 153,942,560 Y63H possibly damaging Het
Chd5 A T 4: 152,379,421 E1449V probably null Het
Chml A G 1: 175,688,028 V109A probably benign Het
Crybg3 G T 16: 59,554,474 S2139* probably null Het
Cyp2c68 T C 19: 39,734,336 D256G probably damaging Het
Dchs2 G T 3: 83,346,227 V2315L probably damaging Het
Ddx20 T C 3: 105,683,420 I227V possibly damaging Het
Drg2 T C 11: 60,462,625 V266A possibly damaging Het
Flcn C A 11: 59,792,622 E576D probably benign Het
Fstl5 T A 3: 76,410,592 D188E probably damaging Het
Gm14496 A G 2: 181,997,530 Q471R probably benign Het
Gm43772 T C 5: 66,174,991 probably benign Het
Gpc6 C T 14: 117,951,261 H436Y probably damaging Het
Gpr179 A T 11: 97,335,802 C1842* probably null Het
Ints8 G A 4: 11,208,845 T934I possibly damaging Het
Iqsec1 G T 6: 90,660,987 C1050* probably null Het
Larp4b T C 13: 9,168,757 V510A probably benign Het
Map3k13 A T 16: 21,905,183 D305V possibly damaging Het
Mc5r A T 18: 68,339,247 I226F possibly damaging Het
Mme G A 3: 63,343,508 W323* probably null Het
Mrpl24 A G 3: 87,922,398 Y97C probably benign Het
Mslnl G A 17: 25,746,775 S541N probably benign Het
Npepl1 T C 2: 174,121,057 V412A probably benign Het
Nrg3 T A 14: 39,472,452 K117* probably null Het
Olfr1275 T C 2: 111,230,930 T288A probably benign Het
Olfr736 G T 14: 50,393,491 C245F probably damaging Het
Orc2 A T 1: 58,467,692 M447K probably benign Het
Phf3 A T 1: 30,804,345 H1844Q probably damaging Het
Plxnc1 T C 10: 94,793,290 I1541V possibly damaging Het
Rapgef4 T C 2: 72,179,949 Y284H possibly damaging Het
Rnf180 C A 13: 105,181,449 probably null Het
Secisbp2 T C 13: 51,665,359 I325T probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Slc4a10 A G 2: 62,268,872 M625V probably benign Het
Synpo T A 18: 60,603,615 M420L probably benign Het
Tmem116 A C 5: 121,517,892 *147C probably null Het
Top2b G A 14: 16,423,779 probably null Het
Trp53bp2 T A 1: 182,455,740 C1014S probably damaging Het
Unc5b A G 10: 60,765,360 F896L probably damaging Het
Vil1 T C 1: 74,419,867 W177R probably damaging Het
Vmn2r107 A T 17: 20,375,054 Y623F probably benign Het
Vmn2r86 T C 10: 130,453,666 Y120C probably damaging Het
Wdr18 A G 10: 79,965,343 T197A possibly damaging Het
Ylpm1 A G 12: 85,029,290 M472V probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp677 A G 17: 21,397,656 Y325C probably damaging Het
Zfyve1 A G 12: 83,558,704 F407S probably damaging Het
Other mutations in A830018L16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:A830018L16Rik APN 1 11748054 missense probably damaging 0.98
IGL01916:A830018L16Rik APN 1 11748107 splice site probably benign
IGL02040:A830018L16Rik APN 1 11933598 intron probably benign
IGL02432:A830018L16Rik APN 1 11748079 missense probably damaging 1.00
IGL02693:A830018L16Rik APN 1 11596282 missense probably damaging 1.00
IGL02736:A830018L16Rik APN 1 11972051 missense probably benign 0.02
IGL03293:A830018L16Rik APN 1 11545151 splice site probably null
IGL02835:A830018L16Rik UTSW 1 11972055 missense possibly damaging 0.54
R1203:A830018L16Rik UTSW 1 11518594 missense probably damaging 1.00
R1216:A830018L16Rik UTSW 1 11798492 missense probably damaging 0.99
R1548:A830018L16Rik UTSW 1 11518594 missense probably damaging 1.00
R1644:A830018L16Rik UTSW 1 11414590 nonsense probably null
R1855:A830018L16Rik UTSW 1 11747971 missense probably damaging 1.00
R1858:A830018L16Rik UTSW 1 11974953 missense unknown
R2265:A830018L16Rik UTSW 1 11972104 critical splice donor site probably null
R2296:A830018L16Rik UTSW 1 11512051 missense possibly damaging 0.94
R2484:A830018L16Rik UTSW 1 11596302 missense probably damaging 1.00
R3730:A830018L16Rik UTSW 1 11545226 missense probably damaging 1.00
R3752:A830018L16Rik UTSW 1 11518680 missense probably damaging 1.00
R3861:A830018L16Rik UTSW 1 11588554 splice site probably benign
R4305:A830018L16Rik UTSW 1 11972076 nonsense probably null
R4306:A830018L16Rik UTSW 1 11972076 nonsense probably null
R4307:A830018L16Rik UTSW 1 11972076 nonsense probably null
R4558:A830018L16Rik UTSW 1 11972076 nonsense probably null
R4598:A830018L16Rik UTSW 1 11747964 critical splice acceptor site probably null
R4652:A830018L16Rik UTSW 1 11537342 intron probably benign
R5492:A830018L16Rik UTSW 1 11545207 missense probably damaging 0.99
R5493:A830018L16Rik UTSW 1 11545207 missense probably damaging 0.99
R5802:A830018L16Rik UTSW 1 11950964 missense probably damaging 1.00
R6082:A830018L16Rik UTSW 1 11798528 missense probably benign 0.04
R6376:A830018L16Rik UTSW 1 11798494 missense probably damaging 0.98
R6453:A830018L16Rik UTSW 1 11798558 missense possibly damaging 0.91
R6757:A830018L16Rik UTSW 1 11596334 makesense probably null
R6833:A830018L16Rik UTSW 1 11588509 missense probably damaging 1.00
R7163:A830018L16Rik UTSW 1 11414624 missense probably damaging 0.96
R7272:A830018L16Rik UTSW 1 11588471 missense probably damaging 0.97
R7566:A830018L16Rik UTSW 1 11951028 missense probably damaging 1.00
R7665:A830018L16Rik UTSW 1 11972099 missense probably damaging 0.96
R8004:A830018L16Rik UTSW 1 11951062 splice site probably benign
R8754:A830018L16Rik UTSW 1 11545248 missense probably benign 0.33
Z1176:A830018L16Rik UTSW 1 11518625 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AATTCCAGCATGTTCTTTGGG -3'
(R):5'- ATTCAAAAGTTTGGTTTCCTCCACC -3'

Sequencing Primer
(F):5'- GTTTCTAATGGGATTCCTTGAAAGAG -3'
(R):5'- TCCACCCAATTACCTGATGATTCAC -3'
Posted On2017-06-26