Incidental Mutation 'R5802:A830018L16Rik'
ID501561
Institutional Source Beutler Lab
Gene Symbol A830018L16Rik
Ensembl Gene ENSMUSG00000057715
Gene NameRIKEN cDNA A830018L16 gene
Synonyms
MMRRC Submission 043391-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5802 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location11414105-11975901 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11950964 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 383 (D383V)
Ref Sequence ENSEMBL: ENSMUSP00000137287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048613] [ENSMUST00000137824] [ENSMUST00000179089]
Predicted Effect probably damaging
Transcript: ENSMUST00000048613
AA Change: D396V

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043857
Gene: ENSMUSG00000057715
AA Change: D396V

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
low complexity region 233 248 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137824
AA Change: D399V

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117421
Gene: ENSMUSG00000057715
AA Change: D399V

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
low complexity region 233 248 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179089
AA Change: D383V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect not run
Transcript: ENSMUST00000185882
AA Change: D399V
Meta Mutation Damage Score 0.2565 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to the cyclic AMP dependent protein kinase regulators. Naturally occurring mutations in this gene are associated with an increased risk for severe toxicities, such as diarrhea and neutropenia, in patients undergoing chemotherapeutic treatment. [provided by RefSeq, Mar 2017]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A T 3: 122,054,232 L67F probably damaging Het
Abcc9 C A 6: 142,656,676 probably null Het
Atp2a3 T C 11: 72,972,882 V175A probably damaging Het
B3galt4 T A 17: 33,950,757 D169V probably damaging Het
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Camkk2 T C 5: 122,734,244 E90G probably damaging Het
Cdon T A 9: 35,454,420 I155N probably damaging Het
Cep70 A G 9: 99,296,405 N519D probably damaging Het
Clgn T C 8: 83,425,614 S582P probably damaging Het
Cnga3 T C 1: 37,260,925 F280S probably damaging Het
Dennd4c C T 4: 86,811,453 T764M probably benign Het
Dis3 A T 14: 99,099,664 S4T probably damaging Het
Dlgap1 T C 17: 70,766,091 probably null Het
Dnah17 C T 11: 118,036,446 V3839I possibly damaging Het
Dnajc1 A G 2: 18,284,739 Y286H probably benign Het
Dynap T A 18: 70,241,002 D151V unknown Het
Ednrb A G 14: 103,821,714 F292S probably damaging Het
Eef1a1 A G 9: 78,479,036 S396P probably damaging Het
Fancg A G 4: 43,006,582 F324S probably benign Het
Fbxw11 T A 11: 32,711,790 S56T probably benign Het
Gm13178 T A 4: 144,703,636 D261V probably damaging Het
Gm14409 T C 2: 177,265,256 T150A possibly damaging Het
Gm17535 G C 9: 3,035,758 V209L probably benign Homo
Gm20767 G A 13: 120,154,913 S96N possibly damaging Het
Gm5592 C T 7: 41,219,105 probably benign Het
Gm7030 A G 17: 36,111,287 probably benign Het
Gpr137 C T 19: 6,942,005 W51* probably null Het
Hbb-bs T C 7: 103,826,672 Y146C probably damaging Het
Herc1 G T 9: 66,462,878 C2982F probably damaging Het
Hnrnpa3 T A 2: 75,665,056 N309K unknown Het
Hydin A T 8: 110,452,060 I1096F possibly damaging Het
Klf12 A G 14: 100,022,894 V133A probably benign Het
Lats2 A T 14: 57,694,418 Y848N probably damaging Het
Loxl3 A G 6: 83,049,289 T453A possibly damaging Het
Ltn1 T G 16: 87,415,681 H664P probably benign Het
Lypd6 C T 2: 50,173,601 T40I probably benign Het
Nbeal1 A T 1: 60,272,221 T1817S probably benign Het
Nub1 A C 5: 24,702,441 Y350S possibly damaging Het
Pbp2 A G 6: 135,309,876 Y158H possibly damaging Het
Ptpru C T 4: 131,788,377 E827K possibly damaging Het
Rap1a A G 3: 105,745,936 Y32H probably damaging Het
Raph1 T C 1: 60,488,673 N1143S possibly damaging Het
Rbl1 T C 2: 157,161,433 T859A probably benign Het
Rom1 A G 19: 8,928,824 L117P probably damaging Het
Senp6 T C 9: 80,118,644 probably benign Het
Sirpb1c T C 3: 15,832,076 M379V probably benign Het
Slc6a4 C T 11: 77,019,236 T439M probably damaging Het
Srsf12 G T 4: 33,230,929 R141L probably damaging Het
Stk10 C T 11: 32,596,748 P335L probably benign Het
Tecpr1 A T 5: 144,206,546 N670K probably benign Het
Tgds T C 14: 118,132,707 E8G probably benign Het
Tmem129 A G 5: 33,657,716 S38P probably damaging Het
Trappc9 T C 15: 72,685,339 E812G probably damaging Het
Trmt10b T A 4: 45,314,236 probably benign Het
Wapl A G 14: 34,692,320 T380A probably damaging Het
Xylt1 A T 7: 117,656,691 T829S probably benign Het
Zc3h6 C T 2: 129,015,559 P666L possibly damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in A830018L16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:A830018L16Rik APN 1 11748054 missense probably damaging 0.98
IGL01916:A830018L16Rik APN 1 11748107 splice site probably benign
IGL02040:A830018L16Rik APN 1 11933598 intron probably benign
IGL02432:A830018L16Rik APN 1 11748079 missense probably damaging 1.00
IGL02693:A830018L16Rik APN 1 11596282 missense probably damaging 1.00
IGL02736:A830018L16Rik APN 1 11972051 missense probably benign 0.02
IGL03293:A830018L16Rik APN 1 11545151 splice site probably null
IGL02835:A830018L16Rik UTSW 1 11972055 missense possibly damaging 0.54
R1203:A830018L16Rik UTSW 1 11518594 missense probably damaging 1.00
R1216:A830018L16Rik UTSW 1 11798492 missense probably damaging 0.99
R1548:A830018L16Rik UTSW 1 11518594 missense probably damaging 1.00
R1644:A830018L16Rik UTSW 1 11414590 nonsense probably null
R1855:A830018L16Rik UTSW 1 11747971 missense probably damaging 1.00
R1858:A830018L16Rik UTSW 1 11974953 missense unknown
R2265:A830018L16Rik UTSW 1 11972104 critical splice donor site probably null
R2296:A830018L16Rik UTSW 1 11512051 missense possibly damaging 0.94
R2484:A830018L16Rik UTSW 1 11596302 missense probably damaging 1.00
R3730:A830018L16Rik UTSW 1 11545226 missense probably damaging 1.00
R3752:A830018L16Rik UTSW 1 11518680 missense probably damaging 1.00
R3861:A830018L16Rik UTSW 1 11588554 splice site probably benign
R4305:A830018L16Rik UTSW 1 11972076 nonsense probably null
R4306:A830018L16Rik UTSW 1 11972076 nonsense probably null
R4307:A830018L16Rik UTSW 1 11972076 nonsense probably null
R4558:A830018L16Rik UTSW 1 11972076 nonsense probably null
R4598:A830018L16Rik UTSW 1 11747964 critical splice acceptor site probably null
R4652:A830018L16Rik UTSW 1 11537342 intron probably benign
R5492:A830018L16Rik UTSW 1 11545207 missense probably damaging 0.99
R5493:A830018L16Rik UTSW 1 11545207 missense probably damaging 0.99
R6007:A830018L16Rik UTSW 1 11511916 critical splice acceptor site probably null
R6082:A830018L16Rik UTSW 1 11798528 missense probably benign 0.04
R6376:A830018L16Rik UTSW 1 11798494 missense probably damaging 0.98
R6453:A830018L16Rik UTSW 1 11798558 missense possibly damaging 0.91
R6757:A830018L16Rik UTSW 1 11596334 makesense probably null
R6833:A830018L16Rik UTSW 1 11588509 missense probably damaging 1.00
R7163:A830018L16Rik UTSW 1 11414624 missense probably damaging 0.96
R7272:A830018L16Rik UTSW 1 11588471 missense probably damaging 0.97
R7566:A830018L16Rik UTSW 1 11951028 missense probably damaging 1.00
R7665:A830018L16Rik UTSW 1 11972099 missense probably damaging 0.96
R8004:A830018L16Rik UTSW 1 11951062 splice site probably benign
Z1176:A830018L16Rik UTSW 1 11518625 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTAGGACGTATCACTCCCTGATTG -3'
(R):5'- TGACAATTAGGATAACACTGAGCC -3'

Sequencing Primer
(F):5'- ACTCCCTGATTGGCTGCAG -3'
(R):5'- ACACTGAGCCAATGGTATTGTG -3'
Posted On2017-12-01