Incidental Mutation 'R0681:Med22'
ID208412
Institutional Source Beutler Lab
Gene Symbol Med22
Ensembl Gene ENSMUSG00000015776
Gene Namemediator complex subunit 22
SynonymsSurf5, Surf-5
MMRRC Submission 038866-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0681 (G1)
Quality Score71
Status Validated
Chromosome2
Chromosomal Location26905262-26910677 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26910379 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 13 (T13A)
Ref Sequence ENSEMBL: ENSMUSP00000116442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015920] [ENSMUST00000015934] [ENSMUST00000102898] [ENSMUST00000102899] [ENSMUST00000129682] [ENSMUST00000139815] [ENSMUST00000147110] [ENSMUST00000167661]
Predicted Effect probably benign
Transcript: ENSMUST00000015920
AA Change: T13A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000015920
Gene: ENSMUSG00000015776
AA Change: T13A

DomainStartEndE-ValueType
Pfam:Med22 20 125 5.7e-40 PFAM
low complexity region 127 141 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000015934
SMART Domains Protein: ENSMUSP00000015934
Gene: ENSMUSG00000015790

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
Pfam:SURF1 106 321 6.7e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083361
Predicted Effect probably benign
Transcript: ENSMUST00000102898
SMART Domains Protein: ENSMUSP00000099962
Gene: ENSMUSG00000062647

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Pfam:Ribosomal_L7Ae 122 216 1.2e-25 PFAM
low complexity region 251 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102899
AA Change: T13A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099963
Gene: ENSMUSG00000015776
AA Change: T13A

DomainStartEndE-ValueType
Pfam:Med22 14 130 5.6e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129673
Predicted Effect probably benign
Transcript: ENSMUST00000129682
Predicted Effect probably benign
Transcript: ENSMUST00000129822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137376
Predicted Effect probably benign
Transcript: ENSMUST00000139815
AA Change: T13A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000116442
Gene: ENSMUSG00000015776
AA Change: T13A

DomainStartEndE-ValueType
Pfam:Med22 14 72 3e-14 PFAM
Pfam:Med22 96 166 2.7e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143678
Predicted Effect probably benign
Transcript: ENSMUST00000147110
SMART Domains Protein: ENSMUSP00000141238
Gene: ENSMUSG00000015790

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
Pfam:SURF1 30 240 5.1e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150776
Predicted Effect probably benign
Transcript: ENSMUST00000167661
SMART Domains Protein: ENSMUSP00000128488
Gene: ENSMUSG00000015790

DomainStartEndE-ValueType
low complexity region 51 66 N/A INTRINSIC
Pfam:SURF1 73 290 5.9e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183520
Meta Mutation Damage Score 0.0610 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein component of the mediator complex, which functions in the regulation of transcription by bridging interactions between gene-specific regulatory factors, RNA polymerase II, and general transcription factors. Alternatively spliced transcript variants encoding different isoforms have been observed. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 G T 8: 83,934,650 probably benign Het
Adgrv1 C A 13: 81,528,530 D1341Y probably damaging Het
Ahdc1 T C 4: 133,065,516 F1356S possibly damaging Het
BC027072 T G 17: 71,749,514 H1056P probably benign Het
Cdk13 A G 13: 17,721,297 probably benign Het
Cfhr1 A T 1: 139,557,511 S66T probably damaging Het
Cldn6 C A 17: 23,681,193 Q44K probably damaging Het
Cntnap5c T C 17: 58,305,555 V863A possibly damaging Het
Col6a4 T A 9: 106,067,144 K1044* probably null Het
Cyb561d1 A G 3: 108,199,267 V212A probably benign Het
Cyp1b1 A G 17: 79,713,846 S156P probably damaging Het
Dock7 G A 4: 99,016,704 H645Y probably damaging Het
Dpp3 T C 19: 4,914,654 N542D probably damaging Het
Fastkd3 C T 13: 68,591,928 probably benign Het
Galnt10 T A 11: 57,769,540 V268D probably damaging Het
Gm13078 A T 4: 143,728,052 T307S probably benign Het
Grb14 G T 2: 64,917,287 A10E probably damaging Het
Grin2c A G 11: 115,249,653 V1213A probably benign Het
Grip1 C T 10: 120,010,230 T570I probably damaging Het
Hif1an T C 19: 44,563,323 Y71H probably benign Het
Hsd17b11 T A 5: 104,003,206 I221L probably benign Het
Htra1 A T 7: 130,979,297 probably benign Het
Igfn1 T C 1: 135,963,853 E2308G possibly damaging Het
Mapk9 T A 11: 49,869,245 S129T probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mtus1 A T 8: 40,993,517 L489Q probably damaging Het
Naprt G A 15: 75,893,632 P120S probably damaging Het
Nwd1 C T 8: 72,662,337 P172L probably damaging Het
Ogfod2 A G 5: 124,112,844 E62G probably null Het
Olfr1445 T C 19: 12,884,079 L66P probably damaging Het
Olfr1445 A G 19: 12,884,546 T222A probably damaging Het
Olfr211 A T 6: 116,494,400 S264C probably damaging Het
Palm A C 10: 79,819,493 T362P probably benign Het
Pcdh8 T C 14: 79,769,960 T388A probably benign Het
Pclo A G 5: 14,675,318 I1397V unknown Het
Per1 A G 11: 69,101,201 E127G probably damaging Het
Plekha1 T C 7: 130,900,623 V30A possibly damaging Het
Rab26 A G 17: 24,527,966 probably benign Het
Rasal2 T C 1: 157,157,180 D999G possibly damaging Het
Rfx5 C T 3: 94,956,355 T105I probably damaging Het
Rrp1b T C 17: 32,060,395 S677P probably damaging Het
Scaf4 G A 16: 90,249,694 P485S unknown Het
Scn5a A T 9: 119,539,640 M273K probably damaging Het
Sec22a C T 16: 35,361,556 probably null Het
Slc10a6 C A 5: 103,612,449 V227F possibly damaging Het
Slc39a3 C G 10: 81,033,731 E31Q probably benign Het
Spsb1 C T 4: 149,906,917 V65I probably benign Het
Tdrd7 T A 4: 46,016,879 M673K probably benign Het
Trim8 C A 19: 46,515,093 S361R possibly damaging Het
Ucp1 T A 8: 83,295,307 M256K possibly damaging Het
Vmn1r46 A T 6: 89,976,964 D265V probably damaging Het
Zbtb5 T C 4: 44,993,787 I532M probably damaging Het
Other mutations in Med22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01576:Med22 APN 2 26908992 critical splice donor site probably null
R3008:Med22 UTSW 2 26908384 unclassified probably benign
R3831:Med22 UTSW 2 26910367 missense probably damaging 1.00
R3832:Med22 UTSW 2 26910367 missense probably damaging 1.00
R3833:Med22 UTSW 2 26910367 missense probably damaging 1.00
R6858:Med22 UTSW 2 26905937 missense possibly damaging 0.91
R7230:Med22 UTSW 2 26908211 missense probably benign
R7852:Med22 UTSW 2 26910364 missense probably damaging 1.00
R7935:Med22 UTSW 2 26910364 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGTGAGTCACATTCCCTCTGC -3'
(R):5'- CGGATTTAAAGCGACAAGGACCCAC -3'

Sequencing Primer
(F):5'- AGTCACATTCCCTCTGCTTTCC -3'
(R):5'- CCACTTCGGACTCTGACAG -3'
Posted On2014-06-25