Incidental Mutation 'R0681:Olfr211'
ID60966
Institutional Source Beutler Lab
Gene Symbol Olfr211
Ensembl Gene ENSMUSG00000053391
Gene Nameolfactory receptor 211
SynonymsGA_x54KRFPKN04-58127726-58128655, MOR253-9
MMRRC Submission 038866-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.544) question?
Stock #R0681 (G1)
Quality Score155
Status Validated
Chromosome6
Chromosomal Location116489091-116498221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116494400 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 264 (S264C)
Ref Sequence ENSEMBL: ENSMUSP00000145330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065786] [ENSMUST00000203700]
Predicted Effect probably damaging
Transcript: ENSMUST00000065786
AA Change: S264C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066524
Gene: ENSMUSG00000053391
AA Change: S264C

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 6.2e-49 PFAM
Pfam:7TM_GPCR_Srsx 34 304 3.4e-6 PFAM
Pfam:7tm_1 40 289 4e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203700
AA Change: S264C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145330
Gene: ENSMUSG00000053391
AA Change: S264C

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 6.2e-49 PFAM
Pfam:7TM_GPCR_Srsx 34 304 3.4e-6 PFAM
Pfam:7tm_1 40 289 4e-24 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 G T 8: 83,934,650 probably benign Het
Adgrv1 C A 13: 81,528,530 D1341Y probably damaging Het
Ahdc1 T C 4: 133,065,516 F1356S possibly damaging Het
BC027072 T G 17: 71,749,514 H1056P probably benign Het
Cdk13 A G 13: 17,721,297 probably benign Het
Cfhr1 A T 1: 139,557,511 S66T probably damaging Het
Cldn6 C A 17: 23,681,193 Q44K probably damaging Het
Cntnap5c T C 17: 58,305,555 V863A possibly damaging Het
Col6a4 T A 9: 106,067,144 K1044* probably null Het
Cyb561d1 A G 3: 108,199,267 V212A probably benign Het
Cyp1b1 A G 17: 79,713,846 S156P probably damaging Het
Dock7 G A 4: 99,016,704 H645Y probably damaging Het
Dpp3 T C 19: 4,914,654 N542D probably damaging Het
Fastkd3 C T 13: 68,591,928 probably benign Het
Galnt10 T A 11: 57,769,540 V268D probably damaging Het
Gm13078 A T 4: 143,728,052 T307S probably benign Het
Grb14 G T 2: 64,917,287 A10E probably damaging Het
Grin2c A G 11: 115,249,653 V1213A probably benign Het
Grip1 C T 10: 120,010,230 T570I probably damaging Het
Hif1an T C 19: 44,563,323 Y71H probably benign Het
Hsd17b11 T A 5: 104,003,206 I221L probably benign Het
Htra1 A T 7: 130,979,297 probably benign Het
Igfn1 T C 1: 135,963,853 E2308G possibly damaging Het
Mapk9 T A 11: 49,869,245 S129T probably damaging Het
Med22 T C 2: 26,910,379 T13A probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mtus1 A T 8: 40,993,517 L489Q probably damaging Het
Naprt G A 15: 75,893,632 P120S probably damaging Het
Nwd1 C T 8: 72,662,337 P172L probably damaging Het
Ogfod2 A G 5: 124,112,844 E62G probably null Het
Olfr1445 T C 19: 12,884,079 L66P probably damaging Het
Olfr1445 A G 19: 12,884,546 T222A probably damaging Het
Palm A C 10: 79,819,493 T362P probably benign Het
Pcdh8 T C 14: 79,769,960 T388A probably benign Het
Pclo A G 5: 14,675,318 I1397V unknown Het
Per1 A G 11: 69,101,201 E127G probably damaging Het
Plekha1 T C 7: 130,900,623 V30A possibly damaging Het
Rab26 A G 17: 24,527,966 probably benign Het
Rasal2 T C 1: 157,157,180 D999G possibly damaging Het
Rfx5 C T 3: 94,956,355 T105I probably damaging Het
Rrp1b T C 17: 32,060,395 S677P probably damaging Het
Scaf4 G A 16: 90,249,694 P485S unknown Het
Scn5a A T 9: 119,539,640 M273K probably damaging Het
Sec22a C T 16: 35,361,556 probably null Het
Slc10a6 C A 5: 103,612,449 V227F possibly damaging Het
Slc39a3 C G 10: 81,033,731 E31Q probably benign Het
Spsb1 C T 4: 149,906,917 V65I probably benign Het
Tdrd7 T A 4: 46,016,879 M673K probably benign Het
Trim8 C A 19: 46,515,093 S361R possibly damaging Het
Ucp1 T A 8: 83,295,307 M256K possibly damaging Het
Vmn1r46 A T 6: 89,976,964 D265V probably damaging Het
Zbtb5 T C 4: 44,993,787 I532M probably damaging Het
Other mutations in Olfr211
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1443:Olfr211 UTSW 6 116494425 missense probably benign 0.08
R1502:Olfr211 UTSW 6 116494281 missense probably damaging 1.00
R1962:Olfr211 UTSW 6 116493764 missense probably benign
R2421:Olfr211 UTSW 6 116493713 missense probably benign
R5151:Olfr211 UTSW 6 116493804 nonsense probably null
R5844:Olfr211 UTSW 6 116493939 missense probably damaging 1.00
R7169:Olfr211 UTSW 6 116494064 missense probably benign 0.01
R7596:Olfr211 UTSW 6 116494197 missense probably benign 0.02
Z1176:Olfr211 UTSW 6 116494376 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCCATTCACACAGGACTGATGAC -3'
(R):5'- ACAGACGAGCCTTTCATATGCTCAC -3'

Sequencing Primer
(F):5'- TCCACCTACGTGAACAGTGTC -3'
(R):5'- TCATATGCTCACAGGATTGCC -3'
Posted On2013-07-30