Incidental Mutation 'R0681:Pcdh8'
ID60977
Institutional Source Beutler Lab
Gene Symbol Pcdh8
Ensembl Gene ENSMUSG00000036422
Gene Nameprotocadherin 8
Synonyms1700080P15Rik, Papc
MMRRC Submission 038866-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0681 (G1)
Quality Score157
Status Validated
Chromosome14
Chromosomal Location79766775-79771312 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79769960 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 388 (T388A)
Ref Sequence ENSEMBL: ENSMUSP00000141417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039568] [ENSMUST00000195355]
Predicted Effect probably benign
Transcript: ENSMUST00000039568
AA Change: T388A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045333
Gene: ENSMUSG00000036422
AA Change: T388A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 45 133 8.69e-2 SMART
CA 157 243 1.22e-14 SMART
CA 268 352 6.08e-24 SMART
low complexity region 360 392 N/A INTRINSIC
CA 414 495 5.34e-20 SMART
CA 519 607 1.57e-26 SMART
CA 636 718 1.12e-4 SMART
transmembrane domain 748 770 N/A INTRINSIC
low complexity region 782 802 N/A INTRINSIC
low complexity region 828 860 N/A INTRINSIC
low complexity region 910 933 N/A INTRINSIC
low complexity region 974 980 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195034
Predicted Effect probably benign
Transcript: ENSMUST00000195355
AA Change: T388A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141417
Gene: ENSMUSG00000036422
AA Change: T388A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 45 133 8.69e-2 SMART
CA 157 243 1.22e-14 SMART
CA 268 352 6.08e-24 SMART
low complexity region 360 392 N/A INTRINSIC
CA 414 495 5.34e-20 SMART
CA 519 607 1.57e-26 SMART
CA 636 718 1.12e-4 SMART
transmembrane domain 748 770 N/A INTRINSIC
low complexity region 813 836 N/A INTRINSIC
low complexity region 877 883 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The gene encodes a type I transmembrane protein composed of an extracellular domain including 6 cadherin ectodomains, a single-pass transmembrane domain and a cytoplasmic tail. Unlike classical cadherins, which are generally encoded by 15-17 exons, this gene includes only 3 exons with the first large exon encoding the extracellular and transmembrane region. Although this gene product is capable of homophilic interaction, it appears to affect cell-cell adhesion indirectly by initiating signaling events that regulate classical cadherin-mediated adhesion. Based on studies on this protein and its orthologs, this protocadherin mainly functions in developing embryos and the central nervous system, but can also function as a tumor suppressor. Alternative splicing yielding isoforms with unique cytoplasmic tails has been reported. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice are viable and fertile, and do not exhibit any gross skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 G T 8: 83,934,650 probably benign Het
Adgrv1 C A 13: 81,528,530 D1341Y probably damaging Het
Ahdc1 T C 4: 133,065,516 F1356S possibly damaging Het
BC027072 T G 17: 71,749,514 H1056P probably benign Het
Cdk13 A G 13: 17,721,297 probably benign Het
Cfhr1 A T 1: 139,557,511 S66T probably damaging Het
Cldn6 C A 17: 23,681,193 Q44K probably damaging Het
Cntnap5c T C 17: 58,305,555 V863A possibly damaging Het
Col6a4 T A 9: 106,067,144 K1044* probably null Het
Cyb561d1 A G 3: 108,199,267 V212A probably benign Het
Cyp1b1 A G 17: 79,713,846 S156P probably damaging Het
Dock7 G A 4: 99,016,704 H645Y probably damaging Het
Dpp3 T C 19: 4,914,654 N542D probably damaging Het
Fastkd3 C T 13: 68,591,928 probably benign Het
Galnt10 T A 11: 57,769,540 V268D probably damaging Het
Gm13078 A T 4: 143,728,052 T307S probably benign Het
Grb14 G T 2: 64,917,287 A10E probably damaging Het
Grin2c A G 11: 115,249,653 V1213A probably benign Het
Grip1 C T 10: 120,010,230 T570I probably damaging Het
Hif1an T C 19: 44,563,323 Y71H probably benign Het
Hsd17b11 T A 5: 104,003,206 I221L probably benign Het
Htra1 A T 7: 130,979,297 probably benign Het
Igfn1 T C 1: 135,963,853 E2308G possibly damaging Het
Mapk9 T A 11: 49,869,245 S129T probably damaging Het
Med22 T C 2: 26,910,379 T13A probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mtus1 A T 8: 40,993,517 L489Q probably damaging Het
Naprt G A 15: 75,893,632 P120S probably damaging Het
Nwd1 C T 8: 72,662,337 P172L probably damaging Het
Ogfod2 A G 5: 124,112,844 E62G probably null Het
Olfr1445 T C 19: 12,884,079 L66P probably damaging Het
Olfr1445 A G 19: 12,884,546 T222A probably damaging Het
Olfr211 A T 6: 116,494,400 S264C probably damaging Het
Palm A C 10: 79,819,493 T362P probably benign Het
Pclo A G 5: 14,675,318 I1397V unknown Het
Per1 A G 11: 69,101,201 E127G probably damaging Het
Plekha1 T C 7: 130,900,623 V30A possibly damaging Het
Rab26 A G 17: 24,527,966 probably benign Het
Rasal2 T C 1: 157,157,180 D999G possibly damaging Het
Rfx5 C T 3: 94,956,355 T105I probably damaging Het
Rrp1b T C 17: 32,060,395 S677P probably damaging Het
Scaf4 G A 16: 90,249,694 P485S unknown Het
Scn5a A T 9: 119,539,640 M273K probably damaging Het
Sec22a C T 16: 35,361,556 probably null Het
Slc10a6 C A 5: 103,612,449 V227F possibly damaging Het
Slc39a3 C G 10: 81,033,731 E31Q probably benign Het
Spsb1 C T 4: 149,906,917 V65I probably benign Het
Tdrd7 T A 4: 46,016,879 M673K probably benign Het
Trim8 C A 19: 46,515,093 S361R possibly damaging Het
Ucp1 T A 8: 83,295,307 M256K possibly damaging Het
Vmn1r46 A T 6: 89,976,964 D265V probably damaging Het
Zbtb5 T C 4: 44,993,787 I532M probably damaging Het
Other mutations in Pcdh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Pcdh8 APN 14 79769246 missense probably damaging 0.99
IGL02611:Pcdh8 APN 14 79767667 missense probably benign 0.00
R0094:Pcdh8 UTSW 14 79768148 missense probably damaging 1.00
R0118:Pcdh8 UTSW 14 79767408 missense probably damaging 1.00
R0558:Pcdh8 UTSW 14 79770076 missense probably damaging 1.00
R0718:Pcdh8 UTSW 14 79770691 missense possibly damaging 0.49
R1281:Pcdh8 UTSW 14 79767726 missense probably damaging 1.00
R1487:Pcdh8 UTSW 14 79769547 missense probably damaging 1.00
R1511:Pcdh8 UTSW 14 79769389 missense possibly damaging 0.46
R1552:Pcdh8 UTSW 14 79770607 missense probably benign 0.20
R1556:Pcdh8 UTSW 14 79770403 missense probably damaging 1.00
R1659:Pcdh8 UTSW 14 79768134 missense probably damaging 1.00
R2062:Pcdh8 UTSW 14 79768211 missense probably damaging 1.00
R2063:Pcdh8 UTSW 14 79768211 missense probably damaging 1.00
R2068:Pcdh8 UTSW 14 79768211 missense probably damaging 1.00
R2920:Pcdh8 UTSW 14 79768714 missense possibly damaging 0.88
R3970:Pcdh8 UTSW 14 79770266 missense possibly damaging 0.78
R4113:Pcdh8 UTSW 14 79767513 missense probably damaging 1.00
R4771:Pcdh8 UTSW 14 79768270 missense possibly damaging 0.48
R4840:Pcdh8 UTSW 14 79770868 missense possibly damaging 0.67
R5169:Pcdh8 UTSW 14 79767655 missense probably benign 0.09
R5187:Pcdh8 UTSW 14 79770154 missense probably damaging 0.99
R5415:Pcdh8 UTSW 14 79770248 nonsense probably null
R5548:Pcdh8 UTSW 14 79767502 missense probably damaging 1.00
R5749:Pcdh8 UTSW 14 79770085 missense probably damaging 1.00
R5778:Pcdh8 UTSW 14 79770757 missense probably damaging 1.00
R5795:Pcdh8 UTSW 14 79770980 missense possibly damaging 0.95
R6313:Pcdh8 UTSW 14 79767651 missense probably benign 0.02
R7472:Pcdh8 UTSW 14 79771251 utr 5 prime probably null
R7540:Pcdh8 UTSW 14 79771103 missense probably benign
R7653:Pcdh8 UTSW 14 79767646 missense probably benign 0.01
R7751:Pcdh8 UTSW 14 79770703 missense probably damaging 0.96
R7836:Pcdh8 UTSW 14 79768661 missense possibly damaging 0.73
R7919:Pcdh8 UTSW 14 79768661 missense possibly damaging 0.73
Z1176:Pcdh8 UTSW 14 79769077 missense probably benign 0.01
Z1177:Pcdh8 UTSW 14 79769881 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TGAGACGTAAGTGGACACGGCTTC -3'
(R):5'- ACAGCCACCTGCAAGGTTATCG -3'

Sequencing Primer
(F):5'- GACACCTCATAGACTGGCTTG -3'
(R):5'- TCAACGACAACGCTCCTGA -3'
Posted On2013-07-30