Incidental Mutation 'R0681:Vmn1r46'
ID60965
Institutional Source Beutler Lab
Gene Symbol Vmn1r46
Ensembl Gene ENSMUSG00000061653
Gene Namevomeronasal 1 receptor 46
SynonymsV1rb8
MMRRC Submission 038866-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R0681 (G1)
Quality Score168
Status Validated
Chromosome6
Chromosomal Location89969313-89986721 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89976964 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 265 (D265V)
Ref Sequence ENSEMBL: ENSMUSP00000154175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075797] [ENSMUST00000205088] [ENSMUST00000226715] [ENSMUST00000228231] [ENSMUST00000228349] [ENSMUST00000228401]
Predicted Effect probably damaging
Transcript: ENSMUST00000075797
AA Change: D265V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000075197
Gene: ENSMUSG00000061653
AA Change: D265V

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:V1R 38 301 5.9e-132 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205088
AA Change: D265V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144888
Gene: ENSMUSG00000061653
AA Change: D265V

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:V1R 38 301 5.9e-132 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226715
AA Change: D265V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000228231
AA Change: D265V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000228349
AA Change: D265V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000228401
AA Change: D265V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 G T 8: 83,934,650 probably benign Het
Adgrv1 C A 13: 81,528,530 D1341Y probably damaging Het
Ahdc1 T C 4: 133,065,516 F1356S possibly damaging Het
BC027072 T G 17: 71,749,514 H1056P probably benign Het
Cdk13 A G 13: 17,721,297 probably benign Het
Cfhr1 A T 1: 139,557,511 S66T probably damaging Het
Cldn6 C A 17: 23,681,193 Q44K probably damaging Het
Cntnap5c T C 17: 58,305,555 V863A possibly damaging Het
Col6a4 T A 9: 106,067,144 K1044* probably null Het
Cyb561d1 A G 3: 108,199,267 V212A probably benign Het
Cyp1b1 A G 17: 79,713,846 S156P probably damaging Het
Dock7 G A 4: 99,016,704 H645Y probably damaging Het
Dpp3 T C 19: 4,914,654 N542D probably damaging Het
Fastkd3 C T 13: 68,591,928 probably benign Het
Galnt10 T A 11: 57,769,540 V268D probably damaging Het
Gm13078 A T 4: 143,728,052 T307S probably benign Het
Grb14 G T 2: 64,917,287 A10E probably damaging Het
Grin2c A G 11: 115,249,653 V1213A probably benign Het
Grip1 C T 10: 120,010,230 T570I probably damaging Het
Hif1an T C 19: 44,563,323 Y71H probably benign Het
Hsd17b11 T A 5: 104,003,206 I221L probably benign Het
Htra1 A T 7: 130,979,297 probably benign Het
Igfn1 T C 1: 135,963,853 E2308G possibly damaging Het
Mapk9 T A 11: 49,869,245 S129T probably damaging Het
Med22 T C 2: 26,910,379 T13A probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mtus1 A T 8: 40,993,517 L489Q probably damaging Het
Naprt G A 15: 75,893,632 P120S probably damaging Het
Nwd1 C T 8: 72,662,337 P172L probably damaging Het
Ogfod2 A G 5: 124,112,844 E62G probably null Het
Olfr1445 T C 19: 12,884,079 L66P probably damaging Het
Olfr1445 A G 19: 12,884,546 T222A probably damaging Het
Olfr211 A T 6: 116,494,400 S264C probably damaging Het
Palm A C 10: 79,819,493 T362P probably benign Het
Pcdh8 T C 14: 79,769,960 T388A probably benign Het
Pclo A G 5: 14,675,318 I1397V unknown Het
Per1 A G 11: 69,101,201 E127G probably damaging Het
Plekha1 T C 7: 130,900,623 V30A possibly damaging Het
Rab26 A G 17: 24,527,966 probably benign Het
Rasal2 T C 1: 157,157,180 D999G possibly damaging Het
Rfx5 C T 3: 94,956,355 T105I probably damaging Het
Rrp1b T C 17: 32,060,395 S677P probably damaging Het
Scaf4 G A 16: 90,249,694 P485S unknown Het
Scn5a A T 9: 119,539,640 M273K probably damaging Het
Sec22a C T 16: 35,361,556 probably null Het
Slc10a6 C A 5: 103,612,449 V227F possibly damaging Het
Slc39a3 C G 10: 81,033,731 E31Q probably benign Het
Spsb1 C T 4: 149,906,917 V65I probably benign Het
Tdrd7 T A 4: 46,016,879 M673K probably benign Het
Trim8 C A 19: 46,515,093 S361R possibly damaging Het
Ucp1 T A 8: 83,295,307 M256K possibly damaging Het
Zbtb5 T C 4: 44,993,787 I532M probably damaging Het
Other mutations in Vmn1r46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02271:Vmn1r46 APN 6 89976904 missense probably damaging 1.00
IGL02488:Vmn1r46 APN 6 89976981 missense probably benign 0.10
IGL03116:Vmn1r46 APN 6 89976916 missense probably benign 0.16
IGL03270:Vmn1r46 APN 6 89976774 missense probably damaging 1.00
R0109:Vmn1r46 UTSW 6 89977062 missense probably benign 0.03
R0126:Vmn1r46 UTSW 6 89976953 missense probably benign
R1501:Vmn1r46 UTSW 6 89976216 missense probably benign 0.03
R1717:Vmn1r46 UTSW 6 89976829 missense probably damaging 1.00
R1937:Vmn1r46 UTSW 6 89976734 missense probably benign 0.00
R4323:Vmn1r46 UTSW 6 89976367 missense probably benign 0.06
R5449:Vmn1r46 UTSW 6 89976361 missense probably benign 0.18
R6062:Vmn1r46 UTSW 6 89976259 missense possibly damaging 0.64
R6385:Vmn1r46 UTSW 6 89976445 missense probably damaging 0.99
R6431:Vmn1r46 UTSW 6 89976407 missense probably benign 0.13
R7126:Vmn1r46 UTSW 6 89976994 missense possibly damaging 0.79
R7391:Vmn1r46 UTSW 6 89976625 missense probably benign 0.23
Z1088:Vmn1r46 UTSW 6 89976741 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTACCTGCCTGCTGAATGTCCT -3'
(R):5'- TGATCCATAGCTCTGATGACAACATACTGAA -3'

Sequencing Primer
(F):5'- CATGTTTTCCACGAAGATGGC -3'
(R):5'- TTCTGCCACACAATGACCAGAA -3'
Posted On2013-07-30