Incidental Mutation 'R0681:Galnt10'
ID60974
Institutional Source Beutler Lab
Gene Symbol Galnt10
Ensembl Gene ENSMUSG00000020520
Gene Namepolypeptide N-acetylgalactosaminyltransferase 10
SynonymsGalnt9, C330012K04Rik, GalNAc-T10
MMRRC Submission 038866-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0681 (G1)
Quality Score102
Status Validated
Chromosome11
Chromosomal Location57645442-57787514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57769540 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 268 (V268D)
Ref Sequence ENSEMBL: ENSMUSP00000065096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066987]
Predicted Effect probably damaging
Transcript: ENSMUST00000066987
AA Change: V268D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065096
Gene: ENSMUSG00000020520
AA Change: V268D

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
low complexity region 38 52 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 145 376 4.7e-8 PFAM
Pfam:Glycos_transf_2 148 333 1.9e-37 PFAM
Pfam:Glyco_tranf_2_2 148 373 3e-7 PFAM
Pfam:Glyco_transf_7C 303 376 2.3e-11 PFAM
RICIN 460 590 4.29e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083872
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GalNAc polypeptide N-acetylgalactosaminyltransferases. These enzymes catalyze the first step in the synthesis of mucin-type oligosaccharides. These proteins transfer GalNAc from UDP-GalNAc to either serine or threonine residues of polypeptide acceptors. The protein encoded by this locus may have increased catalytic activity toward glycosylated peptides compared to activity toward non-glycosylated peptides.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a disruption in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 G T 8: 83,934,650 probably benign Het
Adgrv1 C A 13: 81,528,530 D1341Y probably damaging Het
Ahdc1 T C 4: 133,065,516 F1356S possibly damaging Het
BC027072 T G 17: 71,749,514 H1056P probably benign Het
Cdk13 A G 13: 17,721,297 probably benign Het
Cfhr1 A T 1: 139,557,511 S66T probably damaging Het
Cldn6 C A 17: 23,681,193 Q44K probably damaging Het
Cntnap5c T C 17: 58,305,555 V863A possibly damaging Het
Col6a4 T A 9: 106,067,144 K1044* probably null Het
Cyb561d1 A G 3: 108,199,267 V212A probably benign Het
Cyp1b1 A G 17: 79,713,846 S156P probably damaging Het
Dock7 G A 4: 99,016,704 H645Y probably damaging Het
Dpp3 T C 19: 4,914,654 N542D probably damaging Het
Fastkd3 C T 13: 68,591,928 probably benign Het
Gm13078 A T 4: 143,728,052 T307S probably benign Het
Grb14 G T 2: 64,917,287 A10E probably damaging Het
Grin2c A G 11: 115,249,653 V1213A probably benign Het
Grip1 C T 10: 120,010,230 T570I probably damaging Het
Hif1an T C 19: 44,563,323 Y71H probably benign Het
Hsd17b11 T A 5: 104,003,206 I221L probably benign Het
Htra1 A T 7: 130,979,297 probably benign Het
Igfn1 T C 1: 135,963,853 E2308G possibly damaging Het
Mapk9 T A 11: 49,869,245 S129T probably damaging Het
Med22 T C 2: 26,910,379 T13A probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mtus1 A T 8: 40,993,517 L489Q probably damaging Het
Naprt G A 15: 75,893,632 P120S probably damaging Het
Nwd1 C T 8: 72,662,337 P172L probably damaging Het
Ogfod2 A G 5: 124,112,844 E62G probably null Het
Olfr1445 T C 19: 12,884,079 L66P probably damaging Het
Olfr1445 A G 19: 12,884,546 T222A probably damaging Het
Olfr211 A T 6: 116,494,400 S264C probably damaging Het
Palm A C 10: 79,819,493 T362P probably benign Het
Pcdh8 T C 14: 79,769,960 T388A probably benign Het
Pclo A G 5: 14,675,318 I1397V unknown Het
Per1 A G 11: 69,101,201 E127G probably damaging Het
Plekha1 T C 7: 130,900,623 V30A possibly damaging Het
Rab26 A G 17: 24,527,966 probably benign Het
Rasal2 T C 1: 157,157,180 D999G possibly damaging Het
Rfx5 C T 3: 94,956,355 T105I probably damaging Het
Rrp1b T C 17: 32,060,395 S677P probably damaging Het
Scaf4 G A 16: 90,249,694 P485S unknown Het
Scn5a A T 9: 119,539,640 M273K probably damaging Het
Sec22a C T 16: 35,361,556 probably null Het
Slc10a6 C A 5: 103,612,449 V227F possibly damaging Het
Slc39a3 C G 10: 81,033,731 E31Q probably benign Het
Spsb1 C T 4: 149,906,917 V65I probably benign Het
Tdrd7 T A 4: 46,016,879 M673K probably benign Het
Trim8 C A 19: 46,515,093 S361R possibly damaging Het
Ucp1 T A 8: 83,295,307 M256K possibly damaging Het
Vmn1r46 A T 6: 89,976,964 D265V probably damaging Het
Zbtb5 T C 4: 44,993,787 I532M probably damaging Het
Other mutations in Galnt10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Galnt10 APN 11 57725583 missense probably damaging 1.00
IGL02085:Galnt10 APN 11 57782278 missense probably benign
IGL02154:Galnt10 APN 11 57784705 missense probably damaging 1.00
IGL02418:Galnt10 APN 11 57781168 missense probably benign 0.00
IGL02810:Galnt10 APN 11 57725586 missense probably damaging 0.99
IGL03070:Galnt10 APN 11 57725582 missense probably damaging 1.00
IGL03191:Galnt10 APN 11 57771500 missense probably damaging 1.00
R0257:Galnt10 UTSW 11 57781078 missense probably damaging 1.00
R0483:Galnt10 UTSW 11 57781222 missense probably damaging 1.00
R1102:Galnt10 UTSW 11 57781045 splice site probably benign
R1436:Galnt10 UTSW 11 57771469 missense probably damaging 1.00
R1959:Galnt10 UTSW 11 57765617 missense probably damaging 1.00
R3424:Galnt10 UTSW 11 57645713 missense probably benign
R4445:Galnt10 UTSW 11 57783691 missense probably damaging 0.98
R5183:Galnt10 UTSW 11 57769588 missense probably damaging 1.00
R5369:Galnt10 UTSW 11 57765747 critical splice donor site probably null
R5838:Galnt10 UTSW 11 57781056 missense probably damaging 0.99
R6045:Galnt10 UTSW 11 57783793 missense probably damaging 1.00
R6148:Galnt10 UTSW 11 57784648 missense probably damaging 1.00
R6442:Galnt10 UTSW 11 57765622 missense probably benign 0.03
R6851:Galnt10 UTSW 11 57765632 missense probably damaging 1.00
R6873:Galnt10 UTSW 11 57781219 missense probably damaging 1.00
R7013:Galnt10 UTSW 11 57765584 missense probably benign 0.22
R7696:Galnt10 UTSW 11 57769538 missense probably damaging 1.00
Z1088:Galnt10 UTSW 11 57721331 missense possibly damaging 0.93
Z1177:Galnt10 UTSW 11 57737000 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- CTGCTTACCTTCCAGCTTGGGAAC -3'
(R):5'- GCCCTGGTTACCACCAATATGAGTC -3'

Sequencing Primer
(F):5'- AGGAACTGCTTCCTACAGTG -3'
(R):5'- CCACCAATATGAGTCCAGATAAGTTG -3'
Posted On2013-07-30