Incidental Mutation 'R1921:Ttc7b'
ID213085
Institutional Source Beutler Lab
Gene Symbol Ttc7b
Ensembl Gene ENSMUSG00000033530
Gene Nametetratricopeptide repeat domain 7B
SynonymsTtc7l1
MMRRC Submission 039939-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R1921 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location100300770-100520826 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 100415130 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062957] [ENSMUST00000223020]
Predicted Effect probably null
Transcript: ENSMUST00000062957
SMART Domains Protein: ENSMUSP00000052107
Gene: ENSMUSG00000033530

DomainStartEndE-ValueType
TPR 397 430 8.76e-1 SMART
Blast:TPR 471 514 5e-9 BLAST
TPR 515 548 2.77e1 SMART
TPR 549 582 2.01e0 SMART
TPR 696 729 9.7e0 SMART
TPR 730 763 7.98e-4 SMART
TPR 764 797 6.1e0 SMART
TPR 798 831 2.74e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000223020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223514
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,833,748 N568S probably damaging Het
A2m C A 6: 121,654,612 L623M probably benign Het
Abhd2 T C 7: 79,348,356 I212T possibly damaging Het
Adam7 A C 14: 68,512,625 S449A possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aox3 T C 1: 58,180,651 Y1137H probably damaging Het
Atp11b T C 3: 35,834,325 Y715H probably damaging Het
Atrn A G 2: 130,995,051 Y1145C probably damaging Het
Btbd7 A G 12: 102,793,796 I631T probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cfap45 A G 1: 172,545,112 E458G probably damaging Het
Cptp C T 4: 155,866,538 R157H probably damaging Het
Dcbld1 A C 10: 52,319,651 E318D possibly damaging Het
Ddr2 G T 1: 170,004,245 P197Q probably damaging Het
Dlg5 T C 14: 24,176,571 Y421C probably damaging Het
Dlgap2 A G 8: 14,843,624 K980E probably benign Het
Drc7 T C 8: 95,056,016 V3A unknown Het
Dst T C 1: 34,161,029 V96A probably damaging Het
Ect2l T C 10: 18,143,004 D548G possibly damaging Het
Efcab10 A T 12: 33,398,435 Y89F probably benign Het
Eif1ad CGAGGAGGAGGAGGAGGAGG CGAGGAGGAGGAGGAGG 19: 5,370,058 probably benign Het
Entpd6 A G 2: 150,758,812 T147A probably damaging Het
Fbxl5 T A 5: 43,765,490 E189D probably benign Het
Fer1l6 T A 15: 58,625,231 S1217T probably damaging Het
Frem2 A T 3: 53,653,495 V1197D possibly damaging Het
Fsip2 T A 2: 82,980,783 L2482* probably null Het
Fsip2 A T 2: 82,986,820 D4299V probably benign Het
Gipc3 T A 10: 81,338,215 I242F probably damaging Het
Hoxb1 T A 11: 96,366,112 Y96N probably damaging Het
Ibsp A G 5: 104,310,212 E205G probably damaging Het
Ibtk A G 9: 85,703,082 S1170P probably benign Het
Igfn1 A G 1: 135,966,063 probably null Het
Iqsec1 A G 6: 90,662,895 S954P probably benign Het
Kalrn A T 16: 34,392,093 D28E probably benign Het
Lrmda T C 14: 22,577,870 F52L probably damaging Het
Lrp2 T C 2: 69,523,287 D543G probably damaging Het
Lrrtm3 T C 10: 64,088,378 T337A probably benign Het
Marf1 C T 16: 14,128,601 D1219N possibly damaging Het
Mkln1 A G 6: 31,428,178 K118R probably benign Het
Nedd4l T C 18: 65,167,575 probably null Het
Neu2 A G 1: 87,597,301 E336G probably benign Het
Nfasc A G 1: 132,610,805 F448S probably damaging Het
Nlrx1 C A 9: 44,254,134 E822* probably null Het
Nr5a1 T C 2: 38,694,096 Y437C probably damaging Het
Olfr1224-ps1 A G 2: 89,156,581 V198A probably benign Het
Olfr1353 T A 10: 78,970,141 L164* probably null Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Phtf1 C T 3: 103,969,122 Q13* probably null Het
Pnldc1 A G 17: 12,888,928 L525P possibly damaging Het
Ppl T A 16: 5,106,124 D162V possibly damaging Het
Prkdc T A 16: 15,714,215 S1448T possibly damaging Het
Ptgdr A G 14: 44,853,281 I340T probably benign Het
Recql T C 6: 142,365,589 I458M probably benign Het
Rrbp1 A T 2: 143,988,291 V652E probably benign Het
Rtp1 T A 16: 23,431,410 I175N probably damaging Het
Ryr1 A G 7: 29,054,944 M3523T probably damaging Het
S100a16 T C 3: 90,542,396 L62P probably damaging Het
Samd11 T C 4: 156,248,709 E364G probably damaging Het
Satb1 C A 17: 51,742,115 G603* probably null Het
Shroom3 T A 5: 92,962,365 probably null Het
Slc25a15 A G 8: 22,395,761 S3P probably benign Het
Socs2 A T 10: 95,413,038 L71* probably null Het
Sptbn1 T C 11: 30,104,469 E2208G probably damaging Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Susd1 T A 4: 59,412,191 T121S probably benign Het
Svs3b A T 2: 164,255,928 S158T probably benign Het
Synpo C T 18: 60,603,589 M428I probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar4 A G 10: 23,961,341 D283G probably damaging Het
Tango6 T A 8: 106,688,794 D82E probably benign Het
Tcof1 T C 18: 60,838,855 T127A possibly damaging Het
Tle3 G A 9: 61,411,340 probably null Het
Tmem45a A G 16: 56,822,302 F169L probably benign Het
Trp53rkb T A 2: 166,795,823 V233E probably damaging Het
Tubgcp3 A T 8: 12,621,932 L770* probably null Het
Tut1 G A 19: 8,966,102 G851D probably benign Het
Ubr1 G A 2: 120,930,968 T576I probably benign Het
Vmn1r125 T A 7: 21,272,605 Y143N probably damaging Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Vmn2r95 T A 17: 18,424,313 N70K probably benign Het
Wdr59 A T 8: 111,486,950 L311* probably null Het
Wnt2 A G 6: 18,030,253 L12P unknown Het
Xrn1 T C 9: 95,999,497 I700T probably benign Het
Ypel1 A G 16: 17,082,579 H98R probably benign Het
Zfp219 T C 14: 52,008,234 T434A probably benign Het
Zik1 A C 7: 10,490,016 C385G probably damaging Het
Other mutations in Ttc7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Ttc7b APN 12 100376213 missense probably benign 0.03
IGL01377:Ttc7b APN 12 100355112 missense probably benign 0.21
IGL01617:Ttc7b APN 12 100385956 missense possibly damaging 0.94
IGL02928:Ttc7b APN 12 100403415 missense probably damaging 1.00
IGL03183:Ttc7b APN 12 100373709 splice site probably null
IGL03341:Ttc7b APN 12 100325735 missense possibly damaging 0.66
R0302:Ttc7b UTSW 12 100387179 missense possibly damaging 0.94
R0620:Ttc7b UTSW 12 100500073 splice site probably null
R0625:Ttc7b UTSW 12 100355046 missense probably benign 0.04
R1016:Ttc7b UTSW 12 100403358 missense probably null 1.00
R1131:Ttc7b UTSW 12 100382119 critical splice donor site probably null
R1241:Ttc7b UTSW 12 100403439 missense possibly damaging 0.90
R1710:Ttc7b UTSW 12 100403408 missense probably damaging 0.98
R1803:Ttc7b UTSW 12 100407002 missense possibly damaging 0.94
R1887:Ttc7b UTSW 12 100415130 splice site probably null
R1920:Ttc7b UTSW 12 100415130 splice site probably null
R1922:Ttc7b UTSW 12 100415130 splice site probably null
R2062:Ttc7b UTSW 12 100325689 missense probably damaging 1.00
R2239:Ttc7b UTSW 12 100355001 critical splice donor site probably null
R2380:Ttc7b UTSW 12 100355001 critical splice donor site probably null
R4581:Ttc7b UTSW 12 100500117 missense probably damaging 0.99
R4582:Ttc7b UTSW 12 100500117 missense probably damaging 0.99
R4598:Ttc7b UTSW 12 100500117 missense probably damaging 0.99
R4599:Ttc7b UTSW 12 100500117 missense probably damaging 0.99
R4600:Ttc7b UTSW 12 100500117 missense probably damaging 0.99
R4601:Ttc7b UTSW 12 100500117 missense probably damaging 0.99
R4779:Ttc7b UTSW 12 100403362 missense probably damaging 1.00
R5027:Ttc7b UTSW 12 100301742 missense probably damaging 1.00
R5244:Ttc7b UTSW 12 100348010 missense probably damaging 0.99
R5387:Ttc7b UTSW 12 100446963 missense possibly damaging 0.64
R5739:Ttc7b UTSW 12 100384233 missense probably damaging 1.00
R5997:Ttc7b UTSW 12 100373560 missense probably damaging 0.96
R6223:Ttc7b UTSW 12 100387109 critical splice donor site probably null
R6238:Ttc7b UTSW 12 100495422 missense probably benign 0.31
R6318:Ttc7b UTSW 12 100325677 missense probably damaging 0.99
R6494:Ttc7b UTSW 12 100495407 missense possibly damaging 0.73
R7153:Ttc7b UTSW 12 100355034 missense probably damaging 1.00
R8084:Ttc7b UTSW 12 100384173 missense probably damaging 1.00
R8132:Ttc7b UTSW 12 100446872 missense probably damaging 0.99
R8364:Ttc7b UTSW 12 100325558 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- AGAATCCCATGAAGTGACACAG -3'
(R):5'- AGACGATAGCCAGGCAGTTG -3'

Sequencing Primer
(F):5'- AGTGGCTGCTCACGCATG -3'
(R):5'- GCAGTTGGCAGAAATCTTGTTAC -3'
Posted On2014-07-14