Incidental Mutation 'R1929:Ntrk3'
Institutional Source Beutler Lab
Gene Symbol Ntrk3
Ensembl Gene ENSMUSG00000059146
Gene Nameneurotrophic tyrosine kinase, receptor, type 3
MMRRC Submission 039947-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1929 (G1)
Quality Score225
Status Validated
Chromosomal Location78175959-78738012 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to C at 78516723 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039431] [ENSMUST00000039438] [ENSMUST00000193002] [ENSMUST00000193002] [ENSMUST00000195262] [ENSMUST00000195262] [ENSMUST00000206268]
Predicted Effect probably null
Transcript: ENSMUST00000039431
SMART Domains Protein: ENSMUSP00000037909
Gene: ENSMUSG00000059146

LRRNT 31 63 2.46e-4 SMART
LRRCT 160 208 3.58e-12 SMART
IG 216 302 1.24e-8 SMART
Pfam:I-set 308 392 2.4e-8 PFAM
transmembrane domain 430 452 N/A INTRINSIC
TyrKc 538 810 1.49e-145 SMART
Predicted Effect probably null
Transcript: ENSMUST00000039438
SMART Domains Protein: ENSMUSP00000038324
Gene: ENSMUSG00000059146

LRRNT 31 63 2.46e-4 SMART
LRRCT 160 208 3.58e-12 SMART
IG 216 302 1.24e-8 SMART
Pfam:I-set 308 392 3.1e-8 PFAM
transmembrane domain 429 451 N/A INTRINSIC
PDB:2MFQ|B 497 517 2e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155795
Predicted Effect probably null
Transcript: ENSMUST00000193002
SMART Domains Protein: ENSMUSP00000141534
Gene: ENSMUSG00000059146

LRRNT 31 63 2.46e-4 SMART
LRRCT 160 208 3.58e-12 SMART
IG 216 302 1.24e-8 SMART
Pfam:I-set 308 392 2.4e-8 PFAM
Pfam:Ig_2 312 392 6.9e-4 PFAM
transmembrane domain 430 452 N/A INTRINSIC
TyrKc 538 824 4.29e-137 SMART
Predicted Effect probably null
Transcript: ENSMUST00000193002
SMART Domains Protein: ENSMUSP00000141534
Gene: ENSMUSG00000059146

LRRNT 31 63 2.46e-4 SMART
LRRCT 160 208 3.58e-12 SMART
IG 216 302 1.24e-8 SMART
Pfam:I-set 308 392 2.4e-8 PFAM
Pfam:Ig_2 312 392 6.9e-4 PFAM
transmembrane domain 430 452 N/A INTRINSIC
TyrKc 538 824 4.29e-137 SMART
Predicted Effect probably null
Transcript: ENSMUST00000195262
SMART Domains Protein: ENSMUSP00000141599
Gene: ENSMUSG00000059146

LRRNT 31 63 1.2e-6 SMART
LRRCT 160 208 1.8e-14 SMART
IG 216 302 5.1e-11 SMART
Pfam:I-set 308 392 4.7e-7 PFAM
Pfam:Ig_2 312 392 1.3e-2 PFAM
transmembrane domain 430 452 N/A INTRINSIC
TyrKc 538 849 9.7e-132 SMART
Predicted Effect probably null
Transcript: ENSMUST00000195262
SMART Domains Protein: ENSMUSP00000141599
Gene: ENSMUSG00000059146

LRRNT 31 63 1.2e-6 SMART
LRRCT 160 208 1.8e-14 SMART
IG 216 302 5.1e-11 SMART
Pfam:I-set 308 392 4.7e-7 PFAM
Pfam:Ig_2 312 392 1.3e-2 PFAM
transmembrane domain 430 452 N/A INTRINSIC
TyrKc 538 849 9.7e-132 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206167
Predicted Effect probably benign
Transcript: ENSMUST00000206268
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation and may play a role in the development of proprioceptive neurons that sense body position. Mutations in this gene have been associated with medulloblastomas, secretory breast carcinomas and other cancers. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted mutations show a range of phenotypes including postnatal death at 2-21 days, cardiac defects, reduced numbers of dorsal root ganglia neurons and germ cells, abnormal motor coordination and posture and abnormal sensory innervation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 A T 1: 165,510,297 E160V probably damaging Het
Amdhd2 T C 17: 24,157,886 probably null Het
Angel1 A C 12: 86,702,319 L656V probably damaging Het
Ankrd12 G A 17: 65,986,686 S584L possibly damaging Het
Apbb2 T A 5: 66,307,615 N679Y probably benign Het
Arid3c T A 4: 41,724,744 I364F probably damaging Het
Bcan T A 3: 87,993,094 S611C probably damaging Het
Bnip3 T G 7: 138,894,630 silent Het
Btc T C 5: 91,362,401 Y111C probably damaging Het
Carnmt1 T C 19: 18,703,370 L336P probably damaging Het
Ccdc83 C T 7: 90,224,077 V357I probably damaging Het
Cd2bp2 T C 7: 127,193,878 D324G probably benign Het
Cdc20b A G 13: 113,071,917 T216A probably benign Het
Cdk17 T C 10: 93,228,678 Y270H probably damaging Het
Cenpv T C 11: 62,525,233 E230G probably benign Het
Chst11 T C 10: 83,191,170 Y144H probably damaging Het
Cracr2a T A 6: 127,607,298 F107I probably damaging Het
Cyfip1 G T 7: 55,899,957 R624L probably null Het
Cyp27b1 T A 10: 127,048,312 V11D probably damaging Het
Ddc T C 11: 11,835,764 N308D probably damaging Het
Des T G 1: 75,363,493 M348R probably damaging Het
Dis3l T A 9: 64,330,883 D109V probably damaging Het
Dnah3 T A 7: 119,975,129 I2136F probably benign Het
Dnah9 T C 11: 65,976,398 S2785G probably benign Het
Dopey1 T G 9: 86,494,418 V235G probably damaging Het
Dtx3l A T 16: 35,933,689 D182E possibly damaging Het
Efcab6 A G 15: 83,892,962 probably benign Het
Elac2 T A 11: 64,979,189 S27T probably benign Het
Emsy T G 7: 98,626,623 K352N probably damaging Het
Erbb4 T C 1: 68,198,888 N814S probably damaging Het
Fam71e2 T A 7: 4,758,187 T509S probably benign Het
Fgd6 T C 10: 94,045,006 V574A probably benign Het
Filip1 T C 9: 79,819,930 E469G probably damaging Het
Fmo1 A T 1: 162,833,855 D286E probably damaging Het
Fmo4 A T 1: 162,799,047 I310N possibly damaging Het
Focad A G 4: 88,342,212 N902D unknown Het
Focad A G 4: 88,397,179 S1525G probably benign Het
Fras1 T C 5: 96,667,437 W1338R probably benign Het
Fry A G 5: 150,400,924 I1151V probably null Het
Gm10076 T G 14: 105,681,870 noncoding transcript Het
Gm13088 G A 4: 143,654,142 T437I probably damaging Het
Gm5698 T G 1: 30,977,961 D3A probably damaging Het
Gm8394 A G 10: 85,313,731 noncoding transcript Het
Gngt2 C T 11: 95,845,146 probably benign Het
Gsdma T C 11: 98,671,367 probably null Het
Gtf2h3 A T 5: 124,602,199 probably benign Het
Hkdc1 T C 10: 62,417,898 T35A probably benign Het
Irs1 T C 1: 82,288,459 S679G probably benign Het
Itpr1 T A 6: 108,493,755 C2214S probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kcnk16 A G 14: 20,265,279 V72A probably damaging Het
Lipa T A 19: 34,510,890 R119* probably null Het
Matr3 T A 18: 35,588,325 probably benign Het
Med13l T G 5: 118,728,833 F651V probably benign Het
Mfsd11 T C 11: 116,873,914 V388A probably benign Het
Mki67 C T 7: 135,698,065 V1747I possibly damaging Het
Mms22l T C 4: 24,535,936 probably benign Het
Msh5 A G 17: 35,044,390 I154T probably benign Het
Myo5b G T 18: 74,733,925 L1382F probably damaging Het
Ncbp2 T C 16: 31,956,951 Y138H probably damaging Het
Ndufv1 C A 19: 4,008,347 R359L probably benign Het
Olfr1234 A G 2: 89,363,009 V140A probably benign Het
Olfr376 T A 11: 73,375,601 V287E probably damaging Het
Olfr870 T A 9: 20,171,409 H54L possibly damaging Het
P4ha1 A G 10: 59,371,037 E523G probably damaging Het
Per3 T A 4: 151,018,885 Y530F probably damaging Het
Pes1 C A 11: 3,969,524 L66I probably damaging Het
Pigr G A 1: 130,846,662 probably benign Het
Pkd1l1 A T 11: 8,836,197 probably benign Het
Plch1 T A 3: 63,744,535 K378N probably damaging Het
Plxnb1 T C 9: 109,102,708 probably null Het
Prkdc A G 16: 15,654,817 probably null Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Rab3gap2 T A 1: 185,283,542 probably null Het
Rgs3 A G 4: 62,702,147 I537V probably damaging Het
Rhobtb2 T G 14: 69,796,444 D444A probably damaging Het
Rnf40 T C 7: 127,591,784 S314P probably damaging Het
Rngtt T A 4: 33,500,302 C565* probably null Het
Samd3 A G 10: 26,263,986 probably benign Het
Sec61a2 A G 2: 5,873,736 probably benign Het
Serpina3m G A 12: 104,389,322 A83T probably damaging Het
Serpinb13 A T 1: 106,999,026 I251L possibly damaging Het
Sez6 C T 11: 77,972,932 T439I probably damaging Het
Shc1 G A 3: 89,423,542 G91S probably damaging Het
Slc26a2 A G 18: 61,198,578 C594R possibly damaging Het
Specc1l C T 10: 75,245,604 S278F probably damaging Het
Spg11 C T 2: 122,060,207 V2044M probably damaging Het
Stx18 T A 5: 38,128,039 probably null Het
Suclg2 T C 6: 95,589,094 probably benign Het
Tlr4 A T 4: 66,839,444 H158L probably damaging Het
Tmem131 A G 1: 36,812,271 V966A possibly damaging Het
Tram1l1 T A 3: 124,321,986 I265N probably damaging Het
Trim58 T A 11: 58,640,667 F67Y possibly damaging Het
Ttc19 A G 11: 62,281,824 Q74R probably benign Het
Usp7 T C 16: 8,698,469 S649G probably benign Het
Vmn2r16 A G 5: 109,339,258 Y115C possibly damaging Het
Zfp444 T C 7: 6,189,555 C191R probably damaging Het
Zfp451 A G 1: 33,782,193 F151L probably damaging Het
Zfp451 G A 1: 33,783,856 P99S probably benign Het
Zfp729b A T 13: 67,592,233 C648S probably damaging Het
Zfp799 A G 17: 32,821,803 Y58H probably damaging Het
Zfp804b A G 5: 6,769,748 V1069A probably benign Het
Zfp938 C T 10: 82,225,547 G413D probably damaging Het
Other mutations in Ntrk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Ntrk3 APN 7 78250873 missense probably benign 0.03
IGL00862:Ntrk3 APN 7 78247177 missense probably damaging 1.00
IGL00972:Ntrk3 APN 7 78247322 missense possibly damaging 0.95
IGL00976:Ntrk3 APN 7 78450953 missense probably benign 0.02
IGL02172:Ntrk3 APN 7 78460272 splice site probably benign
IGL02175:Ntrk3 APN 7 78247228 missense probably damaging 1.00
IGL02213:Ntrk3 APN 7 78462931 missense probably benign 0.17
IGL02363:Ntrk3 APN 7 78453337 missense probably benign 0.24
IGL02527:Ntrk3 APN 7 78451949 missense probably benign
IGL02673:Ntrk3 APN 7 78250764 missense probably damaging 1.00
IGL02755:Ntrk3 APN 7 78460439 missense probably benign
IGL02998:Ntrk3 APN 7 78577657 missense probably damaging 0.98
IGL03235:Ntrk3 APN 7 78192592 missense probably damaging 1.00
R1465:Ntrk3 UTSW 7 78356014 splice site probably benign
R1505:Ntrk3 UTSW 7 78460524 missense probably damaging 0.99
R1638:Ntrk3 UTSW 7 78247288 missense probably damaging 1.00
R1641:Ntrk3 UTSW 7 78356074 missense probably damaging 1.00
R1775:Ntrk3 UTSW 7 78356041 missense possibly damaging 0.60
R1786:Ntrk3 UTSW 7 78477935 splice site probably benign
R1827:Ntrk3 UTSW 7 78247301 missense probably damaging 1.00
R1868:Ntrk3 UTSW 7 78192604 missense possibly damaging 0.90
R1873:Ntrk3 UTSW 7 78462839 missense probably benign
R1941:Ntrk3 UTSW 7 78247262 missense probably damaging 1.00
R2132:Ntrk3 UTSW 7 78477935 splice site probably benign
R2214:Ntrk3 UTSW 7 78516772 missense probably damaging 1.00
R2221:Ntrk3 UTSW 7 78198852 missense probably damaging 1.00
R2223:Ntrk3 UTSW 7 78198852 missense probably damaging 1.00
R2271:Ntrk3 UTSW 7 78516723 splice site probably null
R2441:Ntrk3 UTSW 7 78302662 missense probably damaging 1.00
R3108:Ntrk3 UTSW 7 78460515 missense probably benign 0.01
R3109:Ntrk3 UTSW 7 78460515 missense probably benign 0.01
R3959:Ntrk3 UTSW 7 78198842 missense probably damaging 1.00
R4016:Ntrk3 UTSW 7 78462947 splice site probably benign
R4028:Ntrk3 UTSW 7 78192710 missense probably damaging 1.00
R4067:Ntrk3 UTSW 7 78517437 missense probably damaging 1.00
R4398:Ntrk3 UTSW 7 78250769 nonsense probably null
R4664:Ntrk3 UTSW 7 78461099 missense probably damaging 0.99
R5045:Ntrk3 UTSW 7 78460424 missense probably benign 0.13
R5081:Ntrk3 UTSW 7 78577774 missense probably damaging 0.99
R5151:Ntrk3 UTSW 7 78247300 missense probably damaging 1.00
R5249:Ntrk3 UTSW 7 78461166 missense possibly damaging 0.87
R5294:Ntrk3 UTSW 7 78517506 splice site probably null
R5594:Ntrk3 UTSW 7 78451899 missense probably benign 0.10
R5923:Ntrk3 UTSW 7 78451928 missense possibly damaging 0.61
R6878:Ntrk3 UTSW 7 78304372 missense probably benign 0.00
R7083:Ntrk3 UTSW 7 78250839 missense probably damaging 1.00
R7178:Ntrk3 UTSW 7 78356147 missense possibly damaging 0.86
R7487:Ntrk3 UTSW 7 78250713 missense probably damaging 1.00
R7607:Ntrk3 UTSW 7 78250873 missense probably benign 0.03
R7800:Ntrk3 UTSW 7 78302740 missense probably benign 0.09
R7961:Ntrk3 UTSW 7 78453328 missense probably benign
R7976:Ntrk3 UTSW 7 78356206 missense probably damaging 0.97
R8009:Ntrk3 UTSW 7 78453328 missense probably benign
R8032:Ntrk3 UTSW 7 78356059 missense probably damaging 1.00
R8104:Ntrk3 UTSW 7 78577702 missense probably damaging 0.99
R8230:Ntrk3 UTSW 7 78250770 missense probably damaging 1.00
R8254:Ntrk3 UTSW 7 78192578 missense probably damaging 1.00
R8412:Ntrk3 UTSW 7 78356149 missense probably benign 0.02
R8465:Ntrk3 UTSW 7 78462883 missense probably damaging 0.99
R8841:Ntrk3 UTSW 7 78356093 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-07-14