Incidental Mutation 'R1953:Klhl3'
ID217501
Institutional Source Beutler Lab
Gene Symbol Klhl3
Ensembl Gene ENSMUSG00000014164
Gene Namekelch-like 3
SynonymsEG627648, 7530408C15Rik
MMRRC Submission 039967-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1953 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location58000228-58113592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58011208 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 546 (Y546H)
Ref Sequence ENSEMBL: ENSMUSP00000089173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091583] [ENSMUST00000160860]
Predicted Effect probably damaging
Transcript: ENSMUST00000091583
AA Change: Y546H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089173
Gene: ENSMUSG00000014164
AA Change: Y546H

DomainStartEndE-ValueType
BTB 103 200 9.36e-30 SMART
BACK 205 307 7.49e-42 SMART
Kelch 355 400 3.31e-9 SMART
Kelch 401 447 3.82e-14 SMART
Kelch 448 494 1.49e-16 SMART
Kelch 495 543 8.58e-17 SMART
Kelch 544 590 4.93e-17 SMART
Kelch 591 638 4.16e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000160860
AA Change: Y493H

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123701
Gene: ENSMUSG00000014164
AA Change: Y493H

DomainStartEndE-ValueType
BTB 64 161 9.36e-30 SMART
BACK 166 268 7.49e-42 SMART
Kelch 316 361 3.31e-9 SMART
Kelch 362 408 3.82e-14 SMART
Kelch 409 455 1.49e-16 SMART
Kelch 456 504 8.58e-17 SMART
Kelch 505 551 4.93e-17 SMART
Kelch 552 599 4.16e-15 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is ubiquitously expressed and encodes a full-length protein which has an N-terminal BTB domain followed by a BACK domain and six kelch-like repeats in the C-terminus. These kelch-like repeats promote substrate ubiquitination of bound proteins via interaction of the BTB domain with the CUL3 (cullin 3) component of a cullin-RING E3 ubiquitin ligase (CRL) complex. Muatations in this gene cause pseudohypoaldosteronism type IID (PHA2D); a rare Mendelian syndrome featuring hypertension, hyperkalaemia and metabolic acidosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice carrying a point mutation display salt-sensitive hypertension, hyperkalemia and metabolic acidosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik G T 16: 38,827,913 T278K possibly damaging Het
5730455P16Rik A T 11: 80,377,946 D12E probably damaging Het
Abca15 C T 7: 120,361,432 R706C probably damaging Het
Actr1a G A 19: 46,380,948 S209F probably benign Het
Adcy1 A G 11: 7,078,991 N247S probably benign Het
Anapc4 T C 5: 52,839,688 L101S probably damaging Het
Asap3 C T 4: 136,227,456 R60* probably null Het
Ascc3 T C 10: 50,845,630 S2060P probably benign Het
Atp9b G A 18: 80,754,307 T851I possibly damaging Het
Borcs5 A G 6: 134,710,267 H196R unknown Het
Bpifb9b A C 2: 154,311,314 D100A probably damaging Het
Cant1 G C 11: 118,408,783 P247A probably damaging Het
Capza3 A T 6: 140,042,568 I298L possibly damaging Het
Cdh10 T C 15: 18,966,911 probably null Het
Celsr3 T C 9: 108,843,182 V2551A probably benign Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cmtr2 T C 8: 110,221,919 L287P probably damaging Het
Crebbp G A 16: 4,179,449 T257I probably benign Het
Crispld2 G A 8: 120,015,296 V128M probably damaging Het
Crnkl1 G A 2: 145,928,200 A241V probably damaging Het
Dmd T A X: 83,830,517 I1342N probably damaging Het
Dnah10 A G 5: 124,782,268 T2043A probably benign Het
Dscaml1 C T 9: 45,670,224 T447I probably benign Het
Eif2ak3 A G 6: 70,892,554 T742A probably benign Het
Farp1 A G 14: 121,255,482 T499A probably benign Het
Fcgr1 G A 3: 96,287,070 T167I probably damaging Het
Fgd5 C A 6: 92,024,630 H935Q probably benign Het
Fhl4 A T 10: 85,098,307 D203E probably benign Het
Gapt T G 13: 110,353,806 T108P probably damaging Het
Gm12800 T C 4: 101,910,115 I187T probably benign Het
Gm13762 G A 2: 88,973,880 Q4* probably null Het
Gpt2 A G 8: 85,521,384 T419A probably benign Het
Gucy2c A G 6: 136,704,293 V907A probably damaging Het
Hmbs T C 9: 44,337,444 D211G probably damaging Het
Irx5 A G 8: 92,359,810 N174D probably damaging Het
Itfg1 A G 8: 85,831,231 V170A probably benign Het
Itga2b T A 11: 102,458,183 T732S probably benign Het
Lama5 G A 2: 180,190,747 H1670Y possibly damaging Het
Mlst8 AT ATT 17: 24,478,013 probably null Het
Nbeal1 T C 1: 60,234,840 V409A probably damaging Het
Nlgn1 T A 3: 25,436,300 D421V probably damaging Het
Nlrp10 T C 7: 108,925,118 D385G probably benign Het
Nr2e3 T A 9: 59,949,796 D30V probably benign Het
Nyap1 A G 5: 137,735,032 S580P probably benign Het
Olfr1259 A G 2: 89,943,923 L64P probably damaging Het
Olfr1509 T A 14: 52,450,887 V158E probably benign Het
Pex1 A G 5: 3,630,038 H952R probably damaging Het
Plin4 T A 17: 56,103,849 I1061F possibly damaging Het
Pnkp C A 7: 44,862,602 R517S probably benign Het
Polr2e T A 10: 80,038,554 E39D probably benign Het
Prokr1 T C 6: 87,588,593 Y90C probably benign Het
Ptprm A T 17: 66,940,580 S587T probably benign Het
Rere G A 4: 150,616,837 E1225K probably damaging Het
Rsl24d1 G T 9: 73,114,614 probably benign Het
Selp A G 1: 164,126,512 N127S probably benign Het
Slc22a18 C T 7: 143,476,247 T17I probably damaging Het
Smad2 A G 18: 76,262,705 T72A possibly damaging Het
Snx29 G A 16: 11,399,783 W149* probably null Het
Stk31 G T 6: 49,446,478 probably null Het
Sult1e1 T G 5: 87,587,671 probably null Het
Syngap1 G A 17: 26,944,687 R41H possibly damaging Het
Tbc1d17 T A 7: 44,841,398 probably null Het
Tie1 A T 4: 118,472,790 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp47 T A 7: 112,092,876 D848E probably benign Het
Vmn1r72 A G 7: 11,669,804 L239P probably damaging Het
Vmn2r124 T C 17: 18,062,860 I272T probably benign Het
Vwa1 C T 4: 155,773,114 V76M probably damaging Het
Xrn1 G T 9: 96,024,221 probably null Het
Zfp667 G T 7: 6,305,088 V252F probably benign Het
Zranb3 A T 1: 127,999,399 V343D probably damaging Het
Other mutations in Klhl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01790:Klhl3 APN 13 58009422 critical splice acceptor site probably null
IGL01984:Klhl3 APN 13 58011243 splice site probably benign
IGL02022:Klhl3 APN 13 58051064 missense possibly damaging 0.95
IGL02543:Klhl3 APN 13 58018871 missense probably damaging 1.00
bearded_dragon UTSW 13 58011152 missense probably benign 0.00
R0975:Klhl3 UTSW 13 58013863 missense possibly damaging 0.81
R1386:Klhl3 UTSW 13 58030433 missense probably damaging 0.99
R1588:Klhl3 UTSW 13 58013898 missense probably damaging 1.00
R1791:Klhl3 UTSW 13 58033230 missense possibly damaging 0.87
R1894:Klhl3 UTSW 13 58009375 missense probably damaging 1.00
R2116:Klhl3 UTSW 13 58018991 missense probably damaging 0.99
R3114:Klhl3 UTSW 13 58051027 critical splice donor site probably null
R4082:Klhl3 UTSW 13 58018797 missense probably null 1.00
R4717:Klhl3 UTSW 13 58030516 missense probably damaging 1.00
R4857:Klhl3 UTSW 13 58018806 missense probably damaging 1.00
R4934:Klhl3 UTSW 13 58102417 nonsense probably null
R5112:Klhl3 UTSW 13 58018889 missense probably damaging 1.00
R5114:Klhl3 UTSW 13 58018967 missense probably benign 0.24
R5547:Klhl3 UTSW 13 58102429 splice site probably null
R5776:Klhl3 UTSW 13 58005184 missense probably benign 0.00
R6236:Klhl3 UTSW 13 58085062 missense probably damaging 1.00
R6268:Klhl3 UTSW 13 58013842 missense probably damaging 1.00
R6457:Klhl3 UTSW 13 58100378 missense probably benign 0.01
R6559:Klhl3 UTSW 13 58016476 missense probably damaging 1.00
R6580:Klhl3 UTSW 13 58018887 missense possibly damaging 0.75
R6601:Klhl3 UTSW 13 58095116 missense probably damaging 0.96
R6669:Klhl3 UTSW 13 58011152 missense probably benign 0.00
R6904:Klhl3 UTSW 13 58030445 missense probably damaging 1.00
R7652:Klhl3 UTSW 13 58113332 start gained probably benign
R7979:Klhl3 UTSW 13 58063797 missense probably benign 0.39
R8112:Klhl3 UTSW 13 58013863 missense possibly damaging 0.81
R8114:Klhl3 UTSW 13 58013863 missense possibly damaging 0.81
R8270:Klhl3 UTSW 13 58113154 missense
R8409:Klhl3 UTSW 13 58019428 missense probably damaging 1.00
Z1177:Klhl3 UTSW 13 58009409 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TATCACTCAGAGCTGGAGGG -3'
(R):5'- TTGAACCTCCTTATTTGCAGGC -3'

Sequencing Primer
(F):5'- AGGGAAGAACTGTGACCCCC -3'
(R):5'- CCAGGCAGGGGATTATCAC -3'
Posted On2014-08-01