Mutagenetix > Incidental Mutations

Incidental Mutation 'R1953:Itga2b'

217498

Institutional Source

Beutler Lab

Gene Symbol

Itga2b

Ensembl Gene

ENSMUSG00000034664

Gene Name

integrin alpha 2b

Synonyms

platelet glycoprotein IIb, GpIIb, alphaIIb, GP IIb, CD41

MMRRC Submission

039967-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.276) question?

Stock #

R1953 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

102453297-102470122 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 102458183 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 732 (T732S)

Ref Sequence

ENSEMBL: ENSMUSP00000099375 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103086]

Predicted Effect

probably benign
Transcript: ENSMUST00000103086
AA Change: T732S

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000099375
Gene: ENSMUSG00000034664
AA Change: T732S

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
Int_alpha	46	103	2.34e-10	SMART
Int_alpha	261	311	1.3e-3	SMART
Int_alpha	315	376	4.9e-13	SMART
Int_alpha	382	438	4.34e-14	SMART
Int_alpha	443	494	4.05e-5	SMART
low complexity region	552	567	N/A	INTRINSIC
SCOP:d1m1xa2	635	770	1e-48	SMART
SCOP:d1m1xa3	775	995	3e-66	SMART
Pfam:Integrin_alpha	1015	1029	5.7e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124767

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128752

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130433

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131247

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134735

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149519

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151625

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174900

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the integrin alpha chain family of proteins. The encoded preproprotein is proteolytically processed to generate light and heavy chains that associate through disulfide linkages to form a subunit of the alpha-IIb/beta-3 integrin cell adhesion receptor. This receptor plays a crucial role in the blood coagulation system, by mediating platelet aggregation. Mutations in this gene are associated with platelet-type bleeding disorders, which are characterized by a failure of platelet aggregation, including Glanzmann thrombasthenia. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a bleeding disorder, lack platelet binding to fibrinogen, absence of fibrinogen in platelet alpha granules, and increased numbers of hematopoietic progenitors in yolk sac, fetal liver, and bone marrow. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930435E12Rik	G	T	16: 38,827,913	T278K	possibly damaging	Het
5730455P16Rik	A	T	11: 80,377,946	D12E	probably damaging	Het
Abca15	C	T	7: 120,361,432	R706C	probably damaging	Het
Actr1a	G	A	19: 46,380,948	S209F	probably benign	Het
Adcy1	A	G	11: 7,078,991	N247S	probably benign	Het
Anapc4	T	C	5: 52,839,688	L101S	probably damaging	Het
Asap3	C	T	4: 136,227,456	R60*	probably null	Het
Ascc3	T	C	10: 50,845,630	S2060P	probably benign	Het
Atp9b	G	A	18: 80,754,307	T851I	possibly damaging	Het
Borcs5	A	G	6: 134,710,267	H196R	unknown	Het
Bpifb9b	A	C	2: 154,311,314	D100A	probably damaging	Het
Cant1	G	C	11: 118,408,783	P247A	probably damaging	Het
Capza3	A	T	6: 140,042,568	I298L	possibly damaging	Het
Cdh10	T	C	15: 18,966,911		probably null	Het
Celsr3	T	C	9: 108,843,182	V2551A	probably benign	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Cmtr2	T	C	8: 110,221,919	L287P	probably damaging	Het
Crebbp	G	A	16: 4,179,449	T257I	probably benign	Het
Crispld2	G	A	8: 120,015,296	V128M	probably damaging	Het
Crnkl1	G	A	2: 145,928,200	A241V	probably damaging	Het
Dmd	T	A	X: 83,830,517	I1342N	probably damaging	Het
Dnah10	A	G	5: 124,782,268	T2043A	probably benign	Het
Dscaml1	C	T	9: 45,670,224	T447I	probably benign	Het
Eif2ak3	A	G	6: 70,892,554	T742A	probably benign	Het
Farp1	A	G	14: 121,255,482	T499A	probably benign	Het
Fcgr1	G	A	3: 96,287,070	T167I	probably damaging	Het
Fgd5	C	A	6: 92,024,630	H935Q	probably benign	Het
Fhl4	A	T	10: 85,098,307	D203E	probably benign	Het
Gapt	T	G	13: 110,353,806	T108P	probably damaging	Het
Gm12800	T	C	4: 101,910,115	I187T	probably benign	Het
Gm13762	G	A	2: 88,973,880	Q4*	probably null	Het
Gpt2	A	G	8: 85,521,384	T419A	probably benign	Het
Gucy2c	A	G	6: 136,704,293	V907A	probably damaging	Het
Hmbs	T	C	9: 44,337,444	D211G	probably damaging	Het
Irx5	A	G	8: 92,359,810	N174D	probably damaging	Het
Itfg1	A	G	8: 85,831,231	V170A	probably benign	Het
Klhl3	A	G	13: 58,011,208	Y546H	probably damaging	Het
Lama5	G	A	2: 180,190,747	H1670Y	possibly damaging	Het
Mlst8	AT	ATT	17: 24,478,013		probably null	Het
Nbeal1	T	C	1: 60,234,840	V409A	probably damaging	Het
Nlgn1	T	A	3: 25,436,300	D421V	probably damaging	Het
Nlrp10	T	C	7: 108,925,118	D385G	probably benign	Het
Nr2e3	T	A	9: 59,949,796	D30V	probably benign	Het
Nyap1	A	G	5: 137,735,032	S580P	probably benign	Het
Olfr1259	A	G	2: 89,943,923	L64P	probably damaging	Het
Olfr1509	T	A	14: 52,450,887	V158E	probably benign	Het
Pex1	A	G	5: 3,630,038	H952R	probably damaging	Het
Plin4	T	A	17: 56,103,849	I1061F	possibly damaging	Het
Pnkp	C	A	7: 44,862,602	R517S	probably benign	Het
Polr2e	T	A	10: 80,038,554	E39D	probably benign	Het
Prokr1	T	C	6: 87,588,593	Y90C	probably benign	Het
Ptprm	A	T	17: 66,940,580	S587T	probably benign	Het
Rere	G	A	4: 150,616,837	E1225K	probably damaging	Het
Rsl24d1	G	T	9: 73,114,614		probably benign	Het
Selp	A	G	1: 164,126,512	N127S	probably benign	Het
Slc22a18	C	T	7: 143,476,247	T17I	probably damaging	Het
Smad2	A	G	18: 76,262,705	T72A	possibly damaging	Het
Snx29	G	A	16: 11,399,783	W149*	probably null	Het
Stk31	G	T	6: 49,446,478		probably null	Het
Sult1e1	T	G	5: 87,587,671		probably null	Het
Syngap1	G	A	17: 26,944,687	R41H	possibly damaging	Het
Tbc1d17	T	A	7: 44,841,398		probably null	Het
Tie1	A	T	4: 118,472,790		probably null	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Usp47	T	A	7: 112,092,876	D848E	probably benign	Het
Vmn1r72	A	G	7: 11,669,804	L239P	probably damaging	Het
Vmn2r124	T	C	17: 18,062,860	I272T	probably benign	Het
Vwa1	C	T	4: 155,773,114	V76M	probably damaging	Het
Xrn1	G	T	9: 96,024,221		probably null	Het
Zfp667	G	T	7: 6,305,088	V252F	probably benign	Het
Zranb3	A	T	1: 127,999,399	V343D	probably damaging	Het

Other mutations in Itga2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01637:Itga2b	APN	11	102455583	missense	probably damaging	1.00
IGL02197:Itga2b	APN	11	102466319	missense	probably benign	0.19
IGL02349:Itga2b	APN	11	102461363	missense	probably damaging	0.98
IGL02711:Itga2b	APN	11	102465725	missense	possibly damaging	0.53
R0282:Itga2b	UTSW	11	102460846	missense	probably damaging	0.99
R0349:Itga2b	UTSW	11	102467426	missense	probably damaging	0.98
R0384:Itga2b	UTSW	11	102465362	splice site	probably null
R0403:Itga2b	UTSW	11	102467326	critical splice donor site	probably null
R0452:Itga2b	UTSW	11	102465953	splice site	probably null
R0535:Itga2b	UTSW	11	102457533	missense	possibly damaging	0.65
R1412:Itga2b	UTSW	11	102457005	missense	probably benign	0.00
R1517:Itga2b	UTSW	11	102466325	nonsense	probably null
R1615:Itga2b	UTSW	11	102460137	critical splice donor site	probably null
R1716:Itga2b	UTSW	11	102460777	missense	probably benign	0.30
R2001:Itga2b	UTSW	11	102467339	missense	probably benign
R2216:Itga2b	UTSW	11	102467866	missense	probably benign	0.35
R4193:Itga2b	UTSW	11	102469685	missense	probably benign	0.01
R4770:Itga2b	UTSW	11	102460756	missense	probably damaging	1.00
R4805:Itga2b	UTSW	11	102467866	missense	probably benign	0.00
R4880:Itga2b	UTSW	11	102457722	intron	probably benign
R4906:Itga2b	UTSW	11	102461159	missense	probably benign	0.43
R5112:Itga2b	UTSW	11	102458191	missense	probably damaging	0.99
R5362:Itga2b	UTSW	11	102461135	missense	probably damaging	0.99
R5739:Itga2b	UTSW	11	102465909	missense	probably benign	0.14
R5761:Itga2b	UTSW	11	102466274	missense	probably benign	0.00
R5840:Itga2b	UTSW	11	102461331	missense	probably damaging	1.00
R5851:Itga2b	UTSW	11	102457601	intron	probably benign
R6239:Itga2b	UTSW	11	102465318	missense	possibly damaging	0.61
R6491:Itga2b	UTSW	11	102459869	splice site	probably null
R7426:Itga2b	UTSW	11	102456294	missense	probably benign	0.01
R7635:Itga2b	UTSW	11	102461756	missense	probably damaging	1.00
R7664:Itga2b	UTSW	11	102460840	missense	probably damaging	1.00
R7832:Itga2b	UTSW	11	102457282	missense	probably damaging	0.98
R8120:Itga2b	UTSW	11	102469542	missense	probably damaging	0.98
R8254:Itga2b	UTSW	11	102467386	missense	probably benign	0.16
R8296:Itga2b	UTSW	11	102461159	missense	possibly damaging	0.79
R8362:Itga2b	UTSW	11	102461363	missense	probably damaging	1.00
Z1177:Itga2b	UTSW	11	102467076	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGAAACAAGTCACCGCGG -3'
(R):5'- AGAGGCTTGTCTGCACTCAG -3'

Sequencing Primer
(F):5'- CAAGTCACCGCGGAAGAAAG -3'
(R):5'- AATGAGTCCAGGGTGGCC -3'

Posted On

2014-08-01