Incidental Mutation 'R2048:Ceacam1'
ID222227
Institutional Source Beutler Lab
Gene Symbol Ceacam1
Ensembl Gene ENSMUSG00000074272
Gene Namecarcinoembryonic antigen-related cell adhesion molecule 1
SynonymsCea1, C-CAM, Cc1, Hv2, CD66a, Cea-7, Cea7, Mhv-1, Hv-2, MHVR1, mmCGM1, mCEA1, Bgp1, mmCGM2, Bgp, Cea-1
MMRRC Submission 040055-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R2048 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location25461707-25477603 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 25476688 bp
ZygosityHeterozygous
Amino Acid Change Serine to Tyrosine at position 27 (S27Y)
Ref Sequence ENSEMBL: ENSMUSP00000096265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098666] [ENSMUST00000098668] [ENSMUST00000098669] [ENSMUST00000205308] [ENSMUST00000206171] [ENSMUST00000206583] [ENSMUST00000206676] [ENSMUST00000206687]
Predicted Effect probably benign
Transcript: ENSMUST00000098666
AA Change: S27Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096263
Gene: ENSMUSG00000074272
AA Change: S27Y

DomainStartEndE-ValueType
Pfam:V-set 18 140 1e-21 PFAM
IGc2 158 224 1.61e-7 SMART
IGc2 252 308 5.04e-9 SMART
IGc2 337 401 8.37e-15 SMART
transmembrane domain 426 448 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098668
AA Change: S27Y

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000096265
Gene: ENSMUSG00000074272
AA Change: S27Y

DomainStartEndE-ValueType
Pfam:V-set 12 140 2.4e-21 PFAM
IGc2 157 221 8.37e-15 SMART
transmembrane domain 246 268 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098669
AA Change: S27Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000096266
Gene: ENSMUSG00000074272
AA Change: S27Y

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:V-set 39 141 3.6e-13 PFAM
IGc2 158 224 1.61e-7 SMART
IGc2 252 308 5.04e-9 SMART
IGc2 337 401 8.37e-15 SMART
transmembrane domain 426 448 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205308
AA Change: S27Y

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000206171
AA Change: S27Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206483
Predicted Effect probably benign
Transcript: ENSMUST00000206583
AA Change: S27Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000206676
AA Change: S27Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206687
AA Change: S27Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206981
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Mice lacking appreciable levels of the two isoforms containing 4 Ig domains and having increased levels of the two isoforms containing 2 Ig domains are viable and fertile. They are significantly more resistant to mouse hepatitis virus than wild-type mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 A G 9: 70,740,075 D19G possibly damaging Het
Adhfe1 A G 1: 9,563,553 K342R probably benign Het
Adk A G 14: 21,318,176 N223S probably damaging Het
Aff4 A G 11: 53,398,385 S454G probably benign Het
Ahnak T A 19: 9,007,056 N1901K probably damaging Het
Camsap1 T C 2: 25,929,743 T1578A probably benign Het
Ccdc63 A C 5: 122,130,287 probably null Het
Cit T C 5: 115,886,813 probably null Het
Cntn4 A G 6: 106,437,864 probably benign Het
Cyp2d26 A G 15: 82,792,727 probably benign Het
Cyp3a13 A T 5: 137,909,975 V204E probably damaging Het
Cyp51 G A 5: 4,086,636 probably benign Het
Epb41l4b T G 4: 57,142,866 E96D probably benign Het
Epg5 A G 18: 78,023,987 E2221G probably damaging Het
Fam69a T C 5: 107,910,020 D179G probably damaging Het
Fbxo21 T A 5: 118,008,104 N597K probably damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fsip1 C A 2: 118,241,716 E195D probably damaging Het
Gm10152 T C 7: 144,763,312 F35L unknown Het
Gtpbp6 A C 5: 110,107,065 V87G probably damaging Het
Hal A G 10: 93,491,140 T176A probably damaging Het
Il12rb2 G T 6: 67,360,545 N117K probably benign Het
Kalrn A G 16: 34,252,310 V734A probably benign Het
Klf7 A G 1: 64,078,754 V228A possibly damaging Het
Kng1 A G 16: 23,058,604 Y54C probably damaging Het
Lpcat2 T G 8: 92,869,843 N169K possibly damaging Het
Magohb A T 6: 131,289,422 S40R probably damaging Het
Mgam A G 6: 40,656,429 D186G possibly damaging Het
Mycbp2 A G 14: 103,232,524 probably null Het
Myh15 A G 16: 49,155,565 D1332G probably damaging Het
Myh9 G A 15: 77,771,132 T1208M possibly damaging Het
Ncor2 C T 5: 125,084,932 R426H unknown Het
Nradd T C 9: 110,621,629 E160G probably benign Het
Olfr441 T A 6: 43,116,378 M212K probably benign Het
Olfr819 G A 10: 129,965,992 S230L probably damaging Het
Otog A T 7: 46,287,639 T1591S probably damaging Het
Oxsr1 A G 9: 119,247,074 S389P probably benign Het
Pde3a A G 6: 141,489,006 probably benign Het
Pi4k2b A T 5: 52,748,431 I105L probably benign Het
Pilrb1 T C 5: 137,854,891 R217G possibly damaging Het
Poteg A T 8: 27,456,746 I159L probably benign Het
Ppargc1a A G 5: 51,548,516 F75S probably damaging Het
Ptk2b T G 14: 66,172,505 D466A probably benign Het
Ptpn21 A G 12: 98,689,526 V394A possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Shisa3 G A 5: 67,611,308 E184K possibly damaging Het
Slc4a2 A G 5: 24,431,559 H283R probably damaging Het
Slc9a3 A G 13: 74,163,741 S603G probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tbcd G T 11: 121,540,936 C470F probably damaging Het
Thsd1 A G 8: 22,259,317 R674G probably benign Het
Zbtb11 T A 16: 55,998,009 C599S probably damaging Het
Zfp541 A G 7: 16,078,327 R302G possibly damaging Het
Other mutations in Ceacam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00701:Ceacam1 APN 7 25471914 missense possibly damaging 0.86
IGL01766:Ceacam1 APN 7 25471995 missense probably damaging 1.00
IGL02094:Ceacam1 APN 7 25474543 missense probably damaging 1.00
IGL02869:Ceacam1 APN 7 25476541 missense probably benign 0.07
IGL03325:Ceacam1 APN 7 25476487 missense possibly damaging 0.83
PIT4445001:Ceacam1 UTSW 7 25476456 missense probably damaging 1.00
PIT4810001:Ceacam1 UTSW 7 25471975 missense probably damaging 1.00
R0464:Ceacam1 UTSW 7 25472017 missense possibly damaging 0.64
R1270:Ceacam1 UTSW 7 25466314 splice site probably null
R1771:Ceacam1 UTSW 7 25472044 missense probably benign 0.17
R1819:Ceacam1 UTSW 7 25463860 missense possibly damaging 0.68
R1964:Ceacam1 UTSW 7 25474708 missense probably benign 0.13
R2760:Ceacam1 UTSW 7 25477474 missense probably damaging 0.99
R2857:Ceacam1 UTSW 7 25474017 missense probably damaging 0.96
R2859:Ceacam1 UTSW 7 25474017 missense probably damaging 0.96
R3546:Ceacam1 UTSW 7 25471914 missense probably benign 0.07
R4471:Ceacam1 UTSW 7 25474600 missense possibly damaging 0.93
R4606:Ceacam1 UTSW 7 25474526 missense probably damaging 0.97
R4810:Ceacam1 UTSW 7 25474520 makesense probably null
R5291:Ceacam1 UTSW 7 25471831 missense probably damaging 0.99
R5405:Ceacam1 UTSW 7 25463865 missense probably benign 0.41
R5423:Ceacam1 UTSW 7 25474526 missense probably benign 0.01
R5851:Ceacam1 UTSW 7 25474600 missense possibly damaging 0.70
R5967:Ceacam1 UTSW 7 25474742 missense probably damaging 0.97
R6216:Ceacam1 UTSW 7 25471996 missense probably benign 0.19
R6235:Ceacam1 UTSW 7 25471792 splice site probably null
R6323:Ceacam1 UTSW 7 25474651 missense probably damaging 1.00
R6545:Ceacam1 UTSW 7 25473854 missense probably damaging 1.00
R7371:Ceacam1 UTSW 7 25474720 missense possibly damaging 0.95
R7760:Ceacam1 UTSW 7 25472025 missense probably damaging 1.00
R7790:Ceacam1 UTSW 7 25473950 missense probably damaging 1.00
R7869:Ceacam1 UTSW 7 25476529 missense probably damaging 0.97
R7952:Ceacam1 UTSW 7 25476529 missense probably damaging 0.97
X0028:Ceacam1 UTSW 7 25476420 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGCCCCGTGAAATTCATATTAC -3'
(R):5'- TGTGTAAAACGGCAGACCTG -3'

Sequencing Primer
(F):5'- TCCCTTGTACCAGGCAAA -3'
(R):5'- TCAGGTTGGCAAGCACTTCAG -3'
Posted On2014-08-25