Incidental Mutation 'R0141:Nr3c2'
ID22326
Institutional Source Beutler Lab
Gene Symbol Nr3c2
Ensembl Gene ENSMUSG00000031618
Gene Namenuclear receptor subfamily 3, group C, member 2
SynonymsMR, aldosterone receptor, mineralocorticoid receptor, Mlr
MMRRC Submission 038426-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0141 (G1)
Quality Score225
Status Validated (trace)
Chromosome8
Chromosomal Location76899442-77245012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76908408 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 46 (V46D)
Ref Sequence ENSEMBL: ENSMUSP00000116008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034031] [ENSMUST00000109911] [ENSMUST00000109912] [ENSMUST00000109913] [ENSMUST00000128862] [ENSMUST00000143284] [ENSMUST00000148106]
Predicted Effect probably damaging
Transcript: ENSMUST00000034031
AA Change: V46D

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034031
Gene: ENSMUSG00000031618
AA Change: V46D

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 675 1.89e-31 SMART
low complexity region 690 706 N/A INTRINSIC
HOLI 771 935 7.78e-33 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109911
AA Change: V46D

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105537
Gene: ENSMUSG00000031618
AA Change: V46D

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
HOLI 658 818 1.1e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109912
AA Change: V46D

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105538
Gene: ENSMUSG00000031618
AA Change: V46D

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
low complexity region 686 702 N/A INTRINSIC
HOLI 767 931 7.78e-33 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109913
AA Change: V46D

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105539
Gene: ENSMUSG00000031618
AA Change: V46D

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
low complexity region 686 702 N/A INTRINSIC
HOLI 767 931 7.78e-33 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128862
AA Change: V46D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000143284
AA Change: V46D

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000148106
AA Change: V46D

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118222
Gene: ENSMUSG00000031618
AA Change: V46D

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
Meta Mutation Damage Score 0.1757 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.9%
Validation Efficiency 88% (50/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mineralocorticoid receptor, which mediates aldosterone actions on salt and water balance within restricted target cells. The protein functions as a ligand-dependent transcription factor that binds to mineralocorticoid response elements in order to transactivate target genes. Mutations in this gene cause autosomal dominant pseudohypoaldosteronism type I, a disorder characterized by urinary salt wasting. Defects in this gene are also associated with early onset hypertension with severe exacerbation in pregnancy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit weight loss and symptoms of pseudohypoaldosteronism, and eventually die at around day 10 after birth from renal salt wasting and dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,683,782 N772K probably benign Het
Acot12 A C 13: 91,771,828 D294A probably benign Het
Adamts9 T C 6: 92,943,085 D24G probably benign Het
Ahnak G A 19: 9,006,680 G1776D probably damaging Het
Arfgef3 C A 10: 18,597,407 C1636F probably damaging Het
AW551984 A G 9: 39,590,644 L722P probably damaging Het
Ccndbp1 T A 2: 121,012,422 M188K probably damaging Het
Col27a1 A T 4: 63,265,633 probably null Het
Cpt1c A G 7: 44,966,671 Y306H probably damaging Het
Cyp3a57 A G 5: 145,362,102 I71V probably benign Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dmrt2 A T 19: 25,678,291 Q418L possibly damaging Het
Ebf1 T C 11: 44,908,000 L284S probably damaging Het
Fam131a G A 16: 20,698,988 A15T probably benign Het
Fbxo17 A G 7: 28,733,491 T146A possibly damaging Het
Fer1l6 A G 15: 58,558,402 E226G probably damaging Het
Galnt18 A T 7: 111,599,031 I174N probably damaging Het
Gm13088 T C 4: 143,654,568 Y295C probably benign Het
Gm44501 T C 17: 40,578,853 I86T probably benign Het
Gm884 A C 11: 103,613,686 I2485M probably damaging Het
Gtsf1l T C 2: 163,087,326 Q79R probably benign Het
Hapln4 T C 8: 70,088,280 L321P probably damaging Het
Herc2 A G 7: 56,121,561 T1024A probably benign Het
Hps5 A G 7: 46,789,181 S43P probably damaging Het
Igsf10 A G 3: 59,330,832 Y643H probably damaging Het
Lama4 G A 10: 39,092,278 R1472H probably benign Het
Lhx9 A G 1: 138,840,006 Y73H possibly damaging Het
Loxl1 T A 9: 58,312,132 Q252L probably damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Olfr1283 T A 2: 111,369,490 I286N probably damaging Het
Olfr152 C G 2: 87,782,705 P55R possibly damaging Het
Olfr487 A C 7: 108,212,003 N175K possibly damaging Het
Olfr495 A T 7: 108,395,368 N83Y probably benign Het
Olfr749 T C 14: 50,736,383 S260G possibly damaging Het
Osbp T C 19: 11,973,859 V256A possibly damaging Het
Pclo A T 5: 14,791,922 D4737V unknown Het
Pkdrej A G 15: 85,815,630 I2035T probably damaging Het
Plek2 A G 12: 78,894,504 S185P probably damaging Het
Pnpla6 G T 8: 3,532,117 probably null Het
Pou3f2 T C 4: 22,487,210 T308A possibly damaging Het
Pxmp4 A G 2: 154,592,295 V82A probably damaging Het
Rnf6 A T 5: 146,211,835 N135K possibly damaging Het
Rtl1 A G 12: 109,592,948 V819A probably damaging Het
Scn1a C A 2: 66,289,062 V1355L probably damaging Het
Scn2a T A 2: 65,711,816 N754K probably benign Het
Serpina3b A T 12: 104,130,771 N104Y probably damaging Het
Sh3rf2 T C 18: 42,156,057 S648P probably benign Het
Slc17a6 G A 7: 51,669,067 V486I probably benign Het
Syne2 T G 12: 75,941,298 D1743E probably damaging Het
Tex14 T G 11: 87,493,031 probably null Het
Tfb1m T C 17: 3,554,957 D87G probably damaging Het
Tll2 C T 19: 41,097,912 G609S probably damaging Het
Tsc22d2 A T 3: 58,417,156 probably benign Het
Tsen2 A G 6: 115,568,829 D360G probably damaging Het
Ugt2b37 G A 5: 87,240,983 P457L probably damaging Het
Vmn1r68 T C 7: 10,527,325 N282S possibly damaging Het
Vmn2r58 G A 7: 41,861,885 S498F probably benign Het
Zfp959 T C 17: 55,898,139 I392T probably benign Het
Other mutations in Nr3c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Nr3c2 APN 8 76909590 missense possibly damaging 0.82
IGL01019:Nr3c2 APN 8 76909214 missense probably damaging 0.99
IGL01085:Nr3c2 APN 8 76908354 missense probably benign 0.02
IGL01395:Nr3c2 APN 8 76908848 missense possibly damaging 0.73
IGL01505:Nr3c2 APN 8 76909187 missense probably damaging 1.00
IGL01656:Nr3c2 APN 8 77187537 missense probably damaging 1.00
IGL01802:Nr3c2 APN 8 76908595 nonsense probably null
IGL02147:Nr3c2 APN 8 76909067 missense probably damaging 0.98
IGL02502:Nr3c2 APN 8 77242514 missense probably damaging 1.00
IGL02706:Nr3c2 APN 8 76908416 unclassified probably null
IGL02945:Nr3c2 APN 8 76909659 missense probably damaging 1.00
IGL03034:Nr3c2 APN 8 77187638 nonsense probably null
IGL03162:Nr3c2 APN 8 77217584 missense probably damaging 0.99
naughty UTSW 8 76908668 unclassified probably null
R0422:Nr3c2 UTSW 8 77185967 missense probably benign
R0458:Nr3c2 UTSW 8 76909538 missense probably damaging 1.00
R0595:Nr3c2 UTSW 8 76909604 missense possibly damaging 0.93
R0615:Nr3c2 UTSW 8 77185889 missense probably benign 0.05
R0964:Nr3c2 UTSW 8 76908668 unclassified probably null
R0989:Nr3c2 UTSW 8 77187564 missense probably damaging 0.97
R1532:Nr3c2 UTSW 8 76909104 missense probably damaging 0.99
R1624:Nr3c2 UTSW 8 76909944 missense probably damaging 1.00
R1737:Nr3c2 UTSW 8 76908329 missense probably benign 0.16
R1965:Nr3c2 UTSW 8 76909463 missense probably damaging 0.99
R2011:Nr3c2 UTSW 8 76909793 missense possibly damaging 0.53
R2110:Nr3c2 UTSW 8 76908527 missense possibly damaging 0.75
R2281:Nr3c2 UTSW 8 76909907 missense probably damaging 0.99
R3782:Nr3c2 UTSW 8 77085684 splice site probably null
R3808:Nr3c2 UTSW 8 76908714 missense probably damaging 1.00
R4133:Nr3c2 UTSW 8 76909749 missense probably damaging 1.00
R4433:Nr3c2 UTSW 8 77217467 missense probably damaging 1.00
R4738:Nr3c2 UTSW 8 76909307 missense possibly damaging 0.94
R4770:Nr3c2 UTSW 8 76908243 intron probably null
R4884:Nr3c2 UTSW 8 76908809 missense possibly damaging 0.53
R5169:Nr3c2 UTSW 8 76909037 missense probably damaging 1.00
R5347:Nr3c2 UTSW 8 77210748 missense possibly damaging 0.92
R5857:Nr3c2 UTSW 8 76908867 missense possibly damaging 0.53
R5878:Nr3c2 UTSW 8 76908268 critical splice acceptor site probably null
R6262:Nr3c2 UTSW 8 76908633 missense possibly damaging 0.65
R6547:Nr3c2 UTSW 8 76908809 missense possibly damaging 0.53
R6820:Nr3c2 UTSW 8 77242457 missense probably damaging 0.98
R7180:Nr3c2 UTSW 8 76908963 missense probably damaging 0.99
R7672:Nr3c2 UTSW 8 76909209 missense probably damaging 1.00
R7741:Nr3c2 UTSW 8 77210646 missense probably damaging 0.97
R7776:Nr3c2 UTSW 8 76909545 missense possibly damaging 0.77
R7800:Nr3c2 UTSW 8 76909992 missense probably damaging 1.00
Z1088:Nr3c2 UTSW 8 76908632 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TGTTCTTTACAAACTGCCAAGGCCC -3'
(R):5'- CCAGAGTCAGGCATGAATGACCTC -3'

Sequencing Primer
(F):5'- GGTACAATTTTAGACTGCCTTAGC -3'
(R):5'- ATAAATCTTTGCCGGGCTCAG -3'
Posted On2013-04-16