Incidental Mutation 'R0141:Fer1l6'
ID22341
Institutional Source Beutler Lab
Gene Symbol Fer1l6
Ensembl Gene ENSMUSG00000037106
Gene Namefer-1-like 6 (C. elegans)
SynonymsEG631797
MMRRC Submission 038426-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R0141 (G1)
Quality Score225
Status Validated (trace)
Chromosome15
Chromosomal Location58510048-58665092 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58558402 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 226 (E226G)
Ref Sequence ENSEMBL: ENSMUSP00000125718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161028]
Predicted Effect probably damaging
Transcript: ENSMUST00000161028
AA Change: E226G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106
AA Change: E226G

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
C2 83 179 4.09e-12 SMART
FerI 165 235 2.06e-36 SMART
C2 243 354 5.19e-14 SMART
low complexity region 412 449 N/A INTRINSIC
FerB 714 787 2.53e-45 SMART
C2 829 936 8.84e-8 SMART
C2 1000 1099 3.05e0 SMART
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
C2 1361 1460 5.78e-12 SMART
low complexity region 1518 1529 N/A INTRINSIC
C2 1601 1731 1.01e-2 SMART
Pfam:Ferlin_C 1765 1857 2.3e-40 PFAM
Meta Mutation Damage Score 0.4277 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.9%
Validation Efficiency 88% (50/57)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,683,782 N772K probably benign Het
Acot12 A C 13: 91,771,828 D294A probably benign Het
Adamts9 T C 6: 92,943,085 D24G probably benign Het
Ahnak G A 19: 9,006,680 G1776D probably damaging Het
Arfgef3 C A 10: 18,597,407 C1636F probably damaging Het
AW551984 A G 9: 39,590,644 L722P probably damaging Het
Ccndbp1 T A 2: 121,012,422 M188K probably damaging Het
Col27a1 A T 4: 63,265,633 probably null Het
Cpt1c A G 7: 44,966,671 Y306H probably damaging Het
Cyp3a57 A G 5: 145,362,102 I71V probably benign Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dmrt2 A T 19: 25,678,291 Q418L possibly damaging Het
Ebf1 T C 11: 44,908,000 L284S probably damaging Het
Fam131a G A 16: 20,698,988 A15T probably benign Het
Fbxo17 A G 7: 28,733,491 T146A possibly damaging Het
Galnt18 A T 7: 111,599,031 I174N probably damaging Het
Gm13088 T C 4: 143,654,568 Y295C probably benign Het
Gm44501 T C 17: 40,578,853 I86T probably benign Het
Gm884 A C 11: 103,613,686 I2485M probably damaging Het
Gtsf1l T C 2: 163,087,326 Q79R probably benign Het
Hapln4 T C 8: 70,088,280 L321P probably damaging Het
Herc2 A G 7: 56,121,561 T1024A probably benign Het
Hps5 A G 7: 46,789,181 S43P probably damaging Het
Igsf10 A G 3: 59,330,832 Y643H probably damaging Het
Lama4 G A 10: 39,092,278 R1472H probably benign Het
Lhx9 A G 1: 138,840,006 Y73H possibly damaging Het
Loxl1 T A 9: 58,312,132 Q252L probably damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nr3c2 T A 8: 76,908,408 V46D probably damaging Het
Olfr1283 T A 2: 111,369,490 I286N probably damaging Het
Olfr152 C G 2: 87,782,705 P55R possibly damaging Het
Olfr487 A C 7: 108,212,003 N175K possibly damaging Het
Olfr495 A T 7: 108,395,368 N83Y probably benign Het
Olfr749 T C 14: 50,736,383 S260G possibly damaging Het
Osbp T C 19: 11,973,859 V256A possibly damaging Het
Pclo A T 5: 14,791,922 D4737V unknown Het
Pkdrej A G 15: 85,815,630 I2035T probably damaging Het
Plek2 A G 12: 78,894,504 S185P probably damaging Het
Pnpla6 G T 8: 3,532,117 probably null Het
Pou3f2 T C 4: 22,487,210 T308A possibly damaging Het
Pxmp4 A G 2: 154,592,295 V82A probably damaging Het
Rnf6 A T 5: 146,211,835 N135K possibly damaging Het
Rtl1 A G 12: 109,592,948 V819A probably damaging Het
Scn1a C A 2: 66,289,062 V1355L probably damaging Het
Scn2a T A 2: 65,711,816 N754K probably benign Het
Serpina3b A T 12: 104,130,771 N104Y probably damaging Het
Sh3rf2 T C 18: 42,156,057 S648P probably benign Het
Slc17a6 G A 7: 51,669,067 V486I probably benign Het
Syne2 T G 12: 75,941,298 D1743E probably damaging Het
Tex14 T G 11: 87,493,031 probably null Het
Tfb1m T C 17: 3,554,957 D87G probably damaging Het
Tll2 C T 19: 41,097,912 G609S probably damaging Het
Tsc22d2 A T 3: 58,417,156 probably benign Het
Tsen2 A G 6: 115,568,829 D360G probably damaging Het
Ugt2b37 G A 5: 87,240,983 P457L probably damaging Het
Vmn1r68 T C 7: 10,527,325 N282S possibly damaging Het
Vmn2r58 G A 7: 41,861,885 S498F probably benign Het
Zfp959 T C 17: 55,898,139 I392T probably benign Het
Other mutations in Fer1l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0009:Fer1l6 UTSW 15 58662787 missense probably damaging 1.00
R0178:Fer1l6 UTSW 15 58637914 splice site probably null
R0304:Fer1l6 UTSW 15 58590562 missense probably benign 0.08
R0379:Fer1l6 UTSW 15 58548338 missense probably benign 0.05
R0457:Fer1l6 UTSW 15 58638094 critical splice donor site probably null
R0546:Fer1l6 UTSW 15 58558408 splice site probably null
R0602:Fer1l6 UTSW 15 58577945 missense probably damaging 0.98
R0619:Fer1l6 UTSW 15 58662935 unclassified probably null
R0669:Fer1l6 UTSW 15 58553724 splice site probably null
R0854:Fer1l6 UTSW 15 58559188 missense probably benign 0.00
R0948:Fer1l6 UTSW 15 58564075 missense probably benign 0.00
R1180:Fer1l6 UTSW 15 58602311 splice site probably benign
R1483:Fer1l6 UTSW 15 58637970 missense possibly damaging 0.84
R1627:Fer1l6 UTSW 15 58641879 missense probably benign 0.41
R1635:Fer1l6 UTSW 15 58647081 missense probably damaging 1.00
R1834:Fer1l6 UTSW 15 58557869 missense possibly damaging 0.58
R1921:Fer1l6 UTSW 15 58625231 missense probably damaging 1.00
R2000:Fer1l6 UTSW 15 58602311 splice site probably benign
R2041:Fer1l6 UTSW 15 58558306 missense probably damaging 1.00
R2144:Fer1l6 UTSW 15 58627534 missense probably benign
R2145:Fer1l6 UTSW 15 58627534 missense probably benign
R2981:Fer1l6 UTSW 15 58564077 missense probably damaging 0.99
R4164:Fer1l6 UTSW 15 58559238 missense possibly damaging 0.83
R4192:Fer1l6 UTSW 15 58647149 missense probably damaging 1.00
R4273:Fer1l6 UTSW 15 58627522 missense probably benign 0.41
R4573:Fer1l6 UTSW 15 58626280 critical splice donor site probably null
R4581:Fer1l6 UTSW 15 58640226 missense probably damaging 1.00
R4624:Fer1l6 UTSW 15 58553705 missense probably damaging 1.00
R4755:Fer1l6 UTSW 15 58640211 missense probably benign 0.09
R4774:Fer1l6 UTSW 15 58577949 missense probably damaging 0.99
R4894:Fer1l6 UTSW 15 58618902 missense probably damaging 1.00
R4896:Fer1l6 UTSW 15 58638020 missense probably damaging 1.00
R4921:Fer1l6 UTSW 15 58600311 critical splice acceptor site probably null
R4962:Fer1l6 UTSW 15 58571401 missense probably benign 0.03
R5029:Fer1l6 UTSW 15 58643920 missense probably benign 0.00
R5134:Fer1l6 UTSW 15 58640154 missense probably damaging 1.00
R5175:Fer1l6 UTSW 15 58550277 missense probably damaging 1.00
R5227:Fer1l6 UTSW 15 58581903 nonsense probably null
R5561:Fer1l6 UTSW 15 58660825 missense probably damaging 0.97
R5621:Fer1l6 UTSW 15 58558326 missense probably damaging 1.00
R5670:Fer1l6 UTSW 15 58622482 missense probably benign 0.00
R5745:Fer1l6 UTSW 15 58571389 missense probably benign 0.01
R5807:Fer1l6 UTSW 15 58590550 nonsense probably null
R5823:Fer1l6 UTSW 15 58590503 nonsense probably null
R5892:Fer1l6 UTSW 15 58564068 missense probably benign
R6006:Fer1l6 UTSW 15 58647044 missense probably damaging 1.00
R6137:Fer1l6 UTSW 15 58559206 missense probably damaging 0.97
R6195:Fer1l6 UTSW 15 58637957 missense probably damaging 1.00
R6234:Fer1l6 UTSW 15 58560639 missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58625177 nonsense probably null
R6237:Fer1l6 UTSW 15 58638006 missense probably damaging 1.00
R6271:Fer1l6 UTSW 15 58641918 missense probably benign 0.01
R6336:Fer1l6 UTSW 15 58559232 nonsense probably null
R6784:Fer1l6 UTSW 15 58571426 missense possibly damaging 0.63
R6852:Fer1l6 UTSW 15 58594878 missense probably damaging 1.00
R7030:Fer1l6 UTSW 15 58629378 missense probably damaging 1.00
R7088:Fer1l6 UTSW 15 58564050 missense possibly damaging 0.69
R7181:Fer1l6 UTSW 15 58575297 missense probably benign 0.00
R7226:Fer1l6 UTSW 15 58590535 missense probably benign 0.00
R7266:Fer1l6 UTSW 15 58627597 missense probably benign
R7463:Fer1l6 UTSW 15 58573601 nonsense probably null
R7464:Fer1l6 UTSW 15 58573247 intron probably null
R7469:Fer1l6 UTSW 15 58590570 splice site probably null
R7483:Fer1l6 UTSW 15 58641945 missense possibly damaging 0.83
R7491:Fer1l6 UTSW 15 58600432 missense probably damaging 1.00
R7534:Fer1l6 UTSW 15 58638026 missense probably damaging 1.00
R7562:Fer1l6 UTSW 15 58560482 missense probably benign 0.00
R7580:Fer1l6 UTSW 15 58558396 missense probably benign 0.41
R7599:Fer1l6 UTSW 15 58627589 missense probably benign
R7607:Fer1l6 UTSW 15 58662732 nonsense probably null
R7677:Fer1l6 UTSW 15 58602290 missense probably benign 0.00
R8202:Fer1l6 UTSW 15 58630637 missense not run
X0021:Fer1l6 UTSW 15 58569202 nonsense probably null
X0027:Fer1l6 UTSW 15 58629340 missense probably damaging 1.00
X0063:Fer1l6 UTSW 15 58618574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAAGCCTCCCAAATGCCTATGAC -3'
(R):5'- AGACATCCGACAGAGCTGAGTCTC -3'

Sequencing Primer
(F):5'- ATGCCTATGACCCATTGGAG -3'
(R):5'- CGACAGAGCTGAGTCTCTGATTG -3'
Posted On2013-04-16