Incidental Mutation 'R2042:Mak'
ID225122
Institutional Source Beutler Lab
Gene Symbol Mak
Ensembl Gene ENSMUSG00000021363
Gene Namemale germ cell-associated kinase
SynonymsA930010O05Rik
MMRRC Submission 040049-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.549) question?
Stock #R2042 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location41025008-41079706 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 41049436 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 179 (S179A)
Ref Sequence ENSEMBL: ENSMUSP00000153314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021792] [ENSMUST00000070193] [ENSMUST00000165087] [ENSMUST00000224423] [ENSMUST00000224740] [ENSMUST00000225084]
Predicted Effect probably benign
Transcript: ENSMUST00000021792
AA Change: S179A

PolyPhen 2 Score 0.277 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000021792
Gene: ENSMUSG00000021363
AA Change: S179A

DomainStartEndE-ValueType
S_TKc 4 284 5.24e-100 SMART
low complexity region 356 369 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070193
AA Change: S148A

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000064750
Gene: ENSMUSG00000021363
AA Change: S148A

DomainStartEndE-ValueType
S_TKc 4 253 3.81e-70 SMART
low complexity region 325 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165087
AA Change: S179A

PolyPhen 2 Score 0.277 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129615
Gene: ENSMUSG00000021363
AA Change: S179A

DomainStartEndE-ValueType
S_TKc 4 284 5.24e-100 SMART
low complexity region 356 369 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224423
AA Change: S179A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect possibly damaging
Transcript: ENSMUST00000224740
AA Change: S179A

PolyPhen 2 Score 0.604 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000225084
AA Change: S179A

PolyPhen 2 Score 0.277 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225789
Meta Mutation Damage Score 0.1158 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a serine/threonine protein kinase related to kinases involved in cell cycle regulation. Studies of the mouse and rat homologs have localized the kinase to the chromosomes during meiosis in spermatogenesis, specifically to the synaptonemal complex that exists while homologous chromosomes are paired. Mutations in this gene have been associated with ciliary defects resulting in retinitis pigmentosa 62. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Males homozygous for a targeted null mutation exhibit slight reductions in litter size and sperm motility in vitro. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T A 3: 124,416,728 probably benign Het
9130019O22Rik A T 7: 127,385,469 C154S possibly damaging Het
Abca16 G A 7: 120,544,718 R1653Q probably benign Het
Ahnak2 T A 12: 112,785,819 Y176F probably damaging Het
Ano6 T C 15: 95,956,023 probably null Het
Atr T C 9: 95,870,022 L564S probably benign Het
Birc6 C G 17: 74,609,659 A1774G probably damaging Het
Cacng1 C T 11: 107,704,308 A148T probably damaging Het
Cd53 T A 3: 106,767,424 probably null Het
Celsr2 A G 3: 108,402,495 F1596S probably damaging Het
Cep120 A T 18: 53,735,742 F122I possibly damaging Het
Ckm A T 7: 19,414,157 H7L possibly damaging Het
Crybg2 T C 4: 134,087,533 V1575A possibly damaging Het
Cspp1 A G 1: 10,112,538 E712G probably damaging Het
Cyp2b23 C A 7: 26,666,108 R434L probably damaging Het
D630003M21Rik A T 2: 158,215,849 S570T probably damaging Het
Dmbt1 A G 7: 131,106,359 I1444V probably damaging Het
Dnah8 T C 17: 30,635,658 V98A probably benign Het
Dtx1 T G 5: 120,694,476 N299T probably benign Het
Efr3b T A 12: 3,984,627 D65V probably damaging Het
Eml4 T C 17: 83,448,178 C323R probably damaging Het
Eps15 C T 4: 109,304,767 T31I probably damaging Het
Fam160a2 G T 7: 105,384,121 Y629* probably null Het
Fam205c C T 4: 42,874,030 C46Y possibly damaging Het
Fam46b T C 4: 133,486,613 V265A possibly damaging Het
Fam91a1 A G 15: 58,426,594 I184V probably benign Het
Fbxl8 A T 8: 105,268,224 I123F probably damaging Het
Fbxw26 T G 9: 109,732,704 T141P probably damaging Het
Glra3 G A 8: 56,062,459 D190N probably benign Het
Hspg2 T C 4: 137,568,366 L4229P probably damaging Het
Ipmk C T 10: 71,363,503 R65W probably damaging Het
Irs2 A G 8: 11,007,580 I284T probably damaging Het
Klhl22 T C 16: 17,792,420 probably benign Het
Lmcd1 T A 6: 112,315,890 D234E probably benign Het
Lrrc14b T C 13: 74,363,442 K173R probably benign Het
Magi1 A T 6: 93,755,045 N209K probably benign Het
Map3k4 C A 17: 12,277,983 R87L probably damaging Het
Map4k1 T C 7: 28,984,130 L53P probably damaging Het
Melk T C 4: 44,309,051 probably null Het
Mks1 C T 11: 87,856,668 probably benign Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
N4bp2 C T 5: 65,826,621 P1670S probably damaging Het
Ncf1 C G 5: 134,226,640 Q132H probably benign Het
Nemp1 T C 10: 127,696,334 S370P possibly damaging Het
Nt5c3b T C 11: 100,436,194 H92R probably benign Het
Olfr1180 G A 2: 88,412,202 A152V possibly damaging Het
Olfr527 T C 7: 140,335,937 L25P probably damaging Het
P4ha3 T C 7: 100,300,690 probably null Het
Pcnx C A 12: 81,918,293 H411Q probably damaging Het
Podxl A G 6: 31,523,116 V473A possibly damaging Het
Prkd2 T C 7: 16,856,268 S530P possibly damaging Het
Scin A G 12: 40,077,510 I427T possibly damaging Het
Sgo2b T C 8: 63,928,527 T424A probably benign Het
Slc22a2 T C 17: 12,599,125 I196T probably benign Het
Slc47a2 C A 11: 61,338,082 V90L probably benign Het
Slc4a7 G A 14: 14,737,386 V99M probably damaging Het
Sprr2k T C 3: 92,433,456 probably benign Het
Spta1 G A 1: 174,211,647 M1185I probably benign Het
Uaca T C 9: 60,869,891 V518A probably damaging Het
Ubr3 C T 2: 69,977,774 Q1200* probably null Het
Ufm1 A G 3: 53,859,281 probably benign Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp142 G A 1: 74,570,619 T1236I probably benign Het
Zfp236 A G 18: 82,633,109 Y845H probably damaging Het
Zfp787 T C 7: 6,132,764 K163E possibly damaging Het
Other mutations in Mak
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Mak APN 13 41055689 splice site probably benign
IGL00543:Mak APN 13 41055713 missense probably damaging 1.00
IGL00772:Mak APN 13 41055820 splice site probably benign
IGL01113:Mak APN 13 41042143 missense probably damaging 1.00
IGL01363:Mak APN 13 41053377 splice site probably benign
IGL01673:Mak APN 13 41048223 splice site probably null
IGL01872:Mak APN 13 41056655 missense probably damaging 1.00
IGL02051:Mak APN 13 41042082 missense probably benign 0.00
R0126:Mak UTSW 13 41032596 missense probably damaging 1.00
R0377:Mak UTSW 13 41049348 missense probably damaging 1.00
R0511:Mak UTSW 13 41046267 missense probably benign
R0557:Mak UTSW 13 41039659 missense probably benign 0.11
R0616:Mak UTSW 13 41042185 missense probably benign 0.05
R0786:Mak UTSW 13 41046069 missense probably benign 0.00
R0855:Mak UTSW 13 41070164 missense probably damaging 1.00
R1430:Mak UTSW 13 41070284 start gained probably benign
R1603:Mak UTSW 13 41042106 missense possibly damaging 0.69
R1759:Mak UTSW 13 41056634 missense probably damaging 0.98
R2148:Mak UTSW 13 41042037 missense probably benign 0.01
R2155:Mak UTSW 13 41032544 missense probably benign 0.00
R4124:Mak UTSW 13 41056630 missense probably benign 0.00
R5040:Mak UTSW 13 41030098 missense possibly damaging 0.61
R5141:Mak UTSW 13 41032563 missense possibly damaging 0.94
R6167:Mak UTSW 13 41053352 missense probably benign 0.07
R6937:Mak UTSW 13 41048102 missense probably damaging 1.00
R6964:Mak UTSW 13 41032591 missense probably benign 0.00
R7201:Mak UTSW 13 41051440 missense possibly damaging 0.94
R7474:Mak UTSW 13 41051480 missense probably damaging 1.00
R7644:Mak UTSW 13 41030110 missense probably benign 0.01
R8057:Mak UTSW 13 41049337 missense probably damaging 1.00
R8247:Mak UTSW 13 41039670 missense possibly damaging 0.76
R8344:Mak UTSW 13 41046203 missense probably benign 0.31
X0024:Mak UTSW 13 41051369 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AATAGCAAGTGAGGGACCACTC -3'
(R):5'- CTAACTGCGGTCAGGAAATAGGTG -3'

Sequencing Primer
(F):5'- ACTCGGAGAAGCCAGGCTAC -3'
(R):5'- CGGTCAGGAAATAGGTGTCTCAC -3'
Posted On2014-08-25