Incidental Mutation 'R2067:Ripor1'
ID 226770
Institutional Source Beutler Lab
Gene Symbol Ripor1
Ensembl Gene ENSMUSG00000038604
Gene Name RHO family interacting cell polarization regulator 1
Synonyms Fam65a, 2310066E14Rik
MMRRC Submission 040072-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.398) question?
Stock # R2067 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 105605255-105622219 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 105617708 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 491 (S491R)
Ref Sequence ENSEMBL: ENSMUSP00000039966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043531] [ENSMUST00000194091]
AlphaFold Q68FE6
Predicted Effect probably benign
Transcript: ENSMUST00000043531
AA Change: S491R

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000039966
Gene: ENSMUSG00000038604
AA Change: S491R

DomainStartEndE-ValueType
Pfam:PL48 17 365 1.7e-170 PFAM
low complexity region 376 391 N/A INTRINSIC
low complexity region 399 413 N/A INTRINSIC
low complexity region 564 586 N/A INTRINSIC
low complexity region 595 655 N/A INTRINSIC
low complexity region 673 688 N/A INTRINSIC
low complexity region 748 771 N/A INTRINSIC
low complexity region 858 870 N/A INTRINSIC
Pfam:HEAT_2 1135 1209 3.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158807
Predicted Effect probably benign
Transcript: ENSMUST00000194091
SMART Domains Protein: ENSMUSP00000142044
Gene: ENSMUSG00000005705

DomainStartEndE-ValueType
Agouti 1 121 2.01e-56 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (76/78)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik T A 4: 122,689,322 probably benign Het
Abca2 A T 2: 25,437,505 I669F possibly damaging Het
Acin1 T A 14: 54,665,254 Q360H probably damaging Het
Aldh3b1 T A 19: 3,921,755 D72V probably benign Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Alpl T C 4: 137,749,545 probably benign Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Bod1l G A 5: 41,817,086 T2295M probably benign Het
Ccdc9 A T 7: 16,278,550 probably null Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Csmd1 A G 8: 15,900,782 S3476P probably benign Het
Ddias A T 7: 92,859,699 M336K possibly damaging Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Epha1 G T 6: 42,366,053 H187Q probably benign Het
Espl1 T C 15: 102,299,090 S330P probably damaging Het
Fbln7 G T 2: 128,877,466 R61L probably damaging Het
Fbxo41 C T 6: 85,478,471 W577* probably null Het
Fgb C A 3: 83,049,689 D25Y probably benign Het
Gc T A 5: 89,446,517 K37N probably damaging Het
Gfpt1 T C 6: 87,057,754 I178T probably benign Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm3944 C A 12: 18,853,894 S8* probably null Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Gpr156 A G 16: 37,978,751 D109G probably benign Het
Hoxd1 A T 2: 74,763,366 T89S probably benign Het
Htt C T 5: 34,825,982 T975I probably benign Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Krt4 C A 15: 101,924,664 A3S possibly damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Mup4 T A 4: 59,960,622 probably benign Het
Myh1 G A 11: 67,214,620 D1079N possibly damaging Het
Myo1a A G 10: 127,705,478 N43D probably benign Het
Napa A T 7: 16,115,278 probably benign Het
Ndufa12 A G 10: 94,220,707 D99G probably damaging Het
Neb A G 2: 52,284,263 I1528T probably benign Het
Nek1 T C 8: 61,007,162 S41P probably damaging Het
Nolc1 C T 19: 46,083,607 T612M probably damaging Het
Nsun5 T G 5: 135,375,072 Y301D probably damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr1085 G T 2: 86,658,437 T7K probably damaging Het
Olfr1170 A G 2: 88,224,474 V186A possibly damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr397 A G 11: 73,964,914 Y102C probably damaging Het
Olfr522 T A 7: 140,162,909 I14F possibly damaging Het
Olfr910 T A 9: 38,539,280 N128K probably benign Het
Osmr T C 15: 6,815,415 N957D probably benign Het
Parn G A 16: 13,603,069 S473L probably damaging Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Pik3c2b T C 1: 133,099,611 S1283P probably damaging Het
Pole2 G A 12: 69,228,152 R5W probably benign Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Ptprz1 A G 6: 23,050,389 probably benign Het
Rapgef3 C A 15: 97,766,961 G7V probably damaging Het
Rnf141 A G 7: 110,821,365 probably benign Het
Ryr3 C T 2: 112,946,957 R285Q probably damaging Het
Sall4 T C 2: 168,756,545 N125S probably benign Het
Schip1 A G 3: 68,617,786 K360R probably damaging Het
Senp6 T A 9: 80,089,869 V55E probably benign Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Slc25a16 T A 10: 62,932,751 H130Q probably benign Het
Styx T C 14: 45,373,563 V217A probably benign Het
Syne2 G A 12: 75,888,342 probably null Het
Tagap1 A G 17: 6,956,860 S146P probably benign Het
Tatdn2 A G 6: 113,704,142 K379E probably benign Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Tle2 T C 10: 81,580,551 L135P probably damaging Het
Tmc1 A G 19: 20,824,309 F451S possibly damaging Het
Trpm7 G A 2: 126,797,727 P1650S probably damaging Het
Ttll4 G A 1: 74,680,382 R16H possibly damaging Het
Ttn T C 2: 76,714,373 N32795S probably damaging Het
Tubgcp6 T C 15: 89,104,489 E803G probably benign Het
Ubr2 A G 17: 46,963,145 probably null Het
Ugt2b35 A G 5: 87,001,553 D221G probably damaging Het
Unc45b G A 11: 82,911,689 A4T probably benign Het
Vmn1r70 A T 7: 10,634,337 I251F possibly damaging Het
Vmn2r120 T A 17: 57,524,553 H412L possibly damaging Het
Zfp59 A G 7: 27,853,510 N129S probably benign Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Ripor1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Ripor1 APN 8 105621433 intron probably benign
IGL00658:Ripor1 APN 8 105618117 intron probably benign
IGL01511:Ripor1 APN 8 105619930 intron probably benign
IGL01733:Ripor1 APN 8 105615746 missense possibly damaging 0.63
IGL02805:Ripor1 APN 8 105617571 missense probably damaging 0.99
IGL03049:Ripor1 APN 8 105615447 missense probably damaging 0.96
IGL03246:Ripor1 APN 8 105615858 missense possibly damaging 0.92
R0650:Ripor1 UTSW 8 105618114 intron probably benign
R1109:Ripor1 UTSW 8 105618928 intron probably benign
R1480:Ripor1 UTSW 8 105615548 missense probably damaging 0.96
R1914:Ripor1 UTSW 8 105616886 missense probably damaging 1.00
R1915:Ripor1 UTSW 8 105616886 missense probably damaging 1.00
R2111:Ripor1 UTSW 8 105614712 missense probably damaging 1.00
R2513:Ripor1 UTSW 8 105617622 missense probably benign 0.27
R4119:Ripor1 UTSW 8 105618857 intron probably benign
R4120:Ripor1 UTSW 8 105618857 intron probably benign
R4415:Ripor1 UTSW 8 105617976 missense probably benign 0.10
R4668:Ripor1 UTSW 8 105614652 missense probably benign 0.30
R4679:Ripor1 UTSW 8 105617785 missense possibly damaging 0.94
R4777:Ripor1 UTSW 8 105614990 missense probably damaging 1.00
R4930:Ripor1 UTSW 8 105617182 missense probably damaging 1.00
R5004:Ripor1 UTSW 8 105618820 frame shift probably null
R5569:Ripor1 UTSW 8 105617515 missense probably damaging 0.98
R5868:Ripor1 UTSW 8 105616004 missense probably damaging 1.00
R7187:Ripor1 UTSW 8 105617874 missense probably benign 0.22
R7311:Ripor1 UTSW 8 105617815 nonsense probably null
R8117:Ripor1 UTSW 8 105617473 missense probably damaging 0.98
R9047:Ripor1 UTSW 8 105616151 missense probably damaging 1.00
R9056:Ripor1 UTSW 8 105617440 missense possibly damaging 0.67
R9172:Ripor1 UTSW 8 105621201 missense unknown
R9246:Ripor1 UTSW 8 105618890 missense unknown
R9267:Ripor1 UTSW 8 105621431 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGAAGAGCCAGCCATGACC -3'
(R):5'- ACACTGTTGACAAGGCTTACAGC -3'

Sequencing Primer
(F):5'- ACCCCATCCCTGGTCAATGG -3'
(R):5'- CACTATATGCAGAGCTTGTCGTAG -3'
Posted On 2014-09-17